Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626678989:

Variant ID: vg0626678989 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 26678989
Reference Allele: AG	Alternative Allele: GG,A
Primary Allele: GG	Secondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGATTTGTATGCAAACTATGCAATTAGTTTTTGTAATCTAAATTTAATGCTCTATGCATGTGTCTAAAGATTCGATGTGTTGTTTTTAGGAAAAAAATT[AG/GG,A]
AAACTATTCAAGGCCTAAGTGAACAAGCATCTACTCCTGTCTAGGCTCAAGGGTCAGGGTGATACCACTGCACTATACCAGCGTCCTACTCCCTCCATCT

Reverse complement sequence

AGATGGAGGGAGTAGGACGCTGGTATAGTGCAGTGGTATCACCCTGACCCTTGAGCCTAGACAGGAGTAGATGCTTGTTCACTTAGGCCTTGAATAGTTT[CT/CC,T]
AATTTTTTTCCTAAAAACAACACATCGAATCTTTAGACACATGCATAGAGCATTAAATTTAGATTACAAAAACTAATTGCATAGTTTGCATACAAATCGC

Allele Frequencies:

Populations	Population Size	Frequency of GG(primary allele)	Frequency of AG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	34.40%	0.15%	0.00%	A: 0.02%
All Indica	2759	97.20%	2.60%	0.22%	0.00%	A: 0.04%
All Japonica	1512	5.60%	94.40%	0.07%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	5.60%	0.64%	0.00%	A: 0.13%
Temperate Japonica	767	4.80%	95.20%	0.00%	0.00%	NA
Tropical Japonica	504	8.50%	91.30%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626678989	AG -> A	LOC_Os06g44230.1	upstream_gene_variant ; 1150.0bp to feature; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N
vg0626678989	AG -> A	LOC_Os06g44220.1	downstream_gene_variant ; 1795.0bp to feature; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N
vg0626678989	AG -> A	LOC_Os06g44220-LOC_Os06g44230	intergenic_region ; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N
vg0626678989	AG -> GG	LOC_Os06g44230.1	upstream_gene_variant ; 1151.0bp to feature; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N
vg0626678989	AG -> GG	LOC_Os06g44220.1	downstream_gene_variant ; 1794.0bp to feature; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N
vg0626678989	AG -> GG	LOC_Os06g44220-LOC_Os06g44230	intergenic_region ; MODIFIER	silent_mutation	Average:71.651; most accessible tissue: Minghui63 panicle, score: 90.624	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0626678989	AG	A	-0.11	0.0	0.01	0.01	0.0	-0.02
vg0626678989	AG	GG	0.0	0.01	0.0	0.03	0.03	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626678989	NA	1.04E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	4.81E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	4.83E-06	1.85E-07	mr1092	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	2.00E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	3.41E-06	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	1.49E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	3.65E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	6.09E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	6.83E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626678989	NA	4.27E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251