\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626643638:

Variant ID: vg0626643638 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26643638
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TACGTGGCAATTTATCTTGAAAAATTATAAAACATGGAGGACCCACATGGCAGTTTCACAAAAAAATAATACTAATAAATAGTGGGACCCGCGTGGGCCC[T/A]
AACTGTCATCCTCTTTCTCCCCTCTTATCTTTGTCATCTTTCTCAGTCTCTCCGGTGGGAGAGGAGCAACGTTCGTGCTCGAGTGCCGGTCGGCGGGAGG

Reverse complement sequence

CCTCCCGCCGACCGGCACTCGAGCACGAACGTTGCTCCTCTCCCACCGGAGAGACTGAGAAAGATGACAAAGATAAGAGGGGAGAAAGAGGATGACAGTT[A/T]
GGGCCCACGCGGGTCCCACTATTTATTAGTATTATTTTTTTGTGAAACTGCCATGTGGGTCCTCCATGTTTTATAATTTTTCAAGATAAATTGCCACGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.40% 0.04% 0.00% NA
All Indica  2759 18.10% 81.80% 0.07% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 3.00% 97.00% 0.00% 0.00% NA
Indica II  465 24.10% 75.90% 0.00% 0.00% NA
Indica III  913 23.90% 75.90% 0.22% 0.00% NA
Indica Intermediate  786 19.20% 80.80% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626643638 T -> A LOC_Os06g44150.1 upstream_gene_variant ; 3881.0bp to feature; MODIFIER silent_mutation Average:86.344; most accessible tissue: Minghui63 flag leaf, score: 94.909 N N N N
vg0626643638 T -> A LOC_Os06g44160.1 downstream_gene_variant ; 2686.0bp to feature; MODIFIER silent_mutation Average:86.344; most accessible tissue: Minghui63 flag leaf, score: 94.909 N N N N
vg0626643638 T -> A LOC_Os06g44160.2 downstream_gene_variant ; 2686.0bp to feature; MODIFIER silent_mutation Average:86.344; most accessible tissue: Minghui63 flag leaf, score: 94.909 N N N N
vg0626643638 T -> A LOC_Os06g44150-LOC_Os06g44160 intergenic_region ; MODIFIER silent_mutation Average:86.344; most accessible tissue: Minghui63 flag leaf, score: 94.909 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626643638 T A 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626643638 NA 1.50E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 1.69E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 1.45E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 7.71E-14 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 3.26E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 2.06E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 6.57E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 1.70E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 4.49E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 3.37E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 1.13E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 8.43E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 1.99E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 6.09E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 1.77E-07 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 7.11E-06 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 5.94E-06 5.25E-09 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 5.37E-38 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 1.08E-07 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 2.29E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 9.30E-06 mr1901_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 6.69E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 3.04E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626643638 NA 2.24E-23 mr1949_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251