\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626631482:

Variant ID: vg0626631482 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26631482
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTATACGACTACTTTTATATTTTCAAAAGCAAACAAACTTAAAATTCAACTCAAACACCAATATGTATGTCCAAAAGCGGACGAACTTGAAAACC[G/A]
ACTCAAACACGGATGACGTATCAAAATACCGATAAAAACATCTTTAATTTTTATAATAGTGAAGATTAATACTTAATTATTTATGTGCTAACGAAAAACC

Reverse complement sequence

GGTTTTTCGTTAGCACATAAATAATTAAGTATTAATCTTCACTATTATAAAAATTAAAGATGTTTTTATCGGTATTTTGATACGTCATCCGTGTTTGAGT[C/T]
GGTTTTCAAGTTCGTCCGCTTTTGGACATACATATTGGTGTTTGAGTTGAATTTTAAGTTTGTTTGCTTTTGAAAATATAAAAGTAGTCGTATAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.40% 0.21% 0.00% NA
All Indica  2759 36.30% 63.40% 0.29% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 87.70% 11.50% 0.74% 0.00% NA
Indica I  595 38.20% 61.30% 0.50% 0.00% NA
Indica II  465 20.20% 79.80% 0.00% 0.00% NA
Indica III  913 33.30% 66.40% 0.33% 0.00% NA
Indica Intermediate  786 47.80% 51.90% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626631482 G -> A LOC_Os06g44140.1 upstream_gene_variant ; 456.0bp to feature; MODIFIER silent_mutation Average:90.451; most accessible tissue: Callus, score: 96.29 N N N N
vg0626631482 G -> A LOC_Os06g44150.1 downstream_gene_variant ; 4150.0bp to feature; MODIFIER silent_mutation Average:90.451; most accessible tissue: Callus, score: 96.29 N N N N
vg0626631482 G -> A LOC_Os06g44130-LOC_Os06g44140 intergenic_region ; MODIFIER silent_mutation Average:90.451; most accessible tissue: Callus, score: 96.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626631482 NA 6.05E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 2.92E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 1.80E-16 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 1.03E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 3.90E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 3.19E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 4.86E-17 mr1034 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 3.84E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626631482 NA 1.32E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251