\
| Variant ID: vg0626631482 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26631482 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )
ATTTTTTATACGACTACTTTTATATTTTCAAAAGCAAACAAACTTAAAATTCAACTCAAACACCAATATGTATGTCCAAAAGCGGACGAACTTGAAAACC[G/A]
ACTCAAACACGGATGACGTATCAAAATACCGATAAAAACATCTTTAATTTTTATAATAGTGAAGATTAATACTTAATTATTTATGTGCTAACGAAAAACC
GGTTTTTCGTTAGCACATAAATAATTAAGTATTAATCTTCACTATTATAAAAATTAAAGATGTTTTTATCGGTATTTTGATACGTCATCCGTGTTTGAGT[C/T]
GGTTTTCAAGTTCGTCCGCTTTTGGACATACATATTGGTGTTTGAGTTGAATTTTAAGTTTGTTTGCTTTTGAAAATATAAAAGTAGTCGTATAAAAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 38.40% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 36.30% | 63.40% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.70% | 11.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 38.20% | 61.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 20.20% | 79.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 33.30% | 66.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 47.80% | 51.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626631482 | G -> A | LOC_Os06g44140.1 | upstream_gene_variant ; 456.0bp to feature; MODIFIER | silent_mutation | Average:90.451; most accessible tissue: Callus, score: 96.29 | N | N | N | N |
| vg0626631482 | G -> A | LOC_Os06g44150.1 | downstream_gene_variant ; 4150.0bp to feature; MODIFIER | silent_mutation | Average:90.451; most accessible tissue: Callus, score: 96.29 | N | N | N | N |
| vg0626631482 | G -> A | LOC_Os06g44130-LOC_Os06g44140 | intergenic_region ; MODIFIER | silent_mutation | Average:90.451; most accessible tissue: Callus, score: 96.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626631482 | NA | 6.05E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 2.92E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 1.80E-16 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 1.03E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 3.90E-14 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 3.19E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 4.86E-17 | mr1034 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 3.84E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626631482 | NA | 1.32E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |