Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626331514:

Variant ID: vg0626331514 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26331514
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCAGTTTGATGCCAAAACTAACCCCGCCATTTTTTTAATGCCAACAATTGATAAGATATAACTATACAACATGATAAACTAAAGATTATTTTACCAA[T/C]
GCTACATTGTAACTCAGAAACTTCTATCATAATAAAAGTTTGAGAAGAGATCAACCTAAATACATCTAATGCTACTGTATAATTTGGTACCAGCAAAATA

Reverse complement sequence

TATTTTGCTGGTACCAAATTATACAGTAGCATTAGATGTATTTAGGTTGATCTCTTCTCAAACTTTTATTATGATAGAAGTTTCTGAGTTACAATGTAGC[A/G]
TTGGTAAAATAATCTTTAGTTTATCATGTTGTATAGTTATATCTTATCAATTGTTGGCATTAAAAAAATGGCGGGGTTAGTTTTGGCATCAAACTGAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.80%	0.80%	0.40%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	96.20%	2.50%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.00%	0.90%	1.04%	0.00%	NA
Tropical Japonica	504	98.20%	1.60%	0.20%	0.00%	NA
Japonica Intermediate	241	86.30%	9.50%	4.15%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626331514	T -> C	LOC_Os06g43750.1	upstream_gene_variant ; 2170.0bp to feature; MODIFIER	silent_mutation	Average:48.74; most accessible tissue: Callus, score: 80.6	N	N	N	N
vg0626331514	T -> C	LOC_Os06g43760.1	upstream_gene_variant ; 1373.0bp to feature; MODIFIER	silent_mutation	Average:48.74; most accessible tissue: Callus, score: 80.6	N	N	N	N
vg0626331514	T -> C	LOC_Os06g43750-LOC_Os06g43760	intergenic_region ; MODIFIER	silent_mutation	Average:48.74; most accessible tissue: Callus, score: 80.6	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626331514	NA	4.24E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	4.94E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	5.07E-06	5.26E-11	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	7.31E-08	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	1.46E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	6.42E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	6.16E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	1.72E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	NA	8.58E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626331514	1.65E-06	NA	mr1962_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251