\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626324304:

Variant ID: vg0626324304 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26324304
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGATATGTAGCCAGCTACAGCACGGATTCCAAGACATAATGTGTATATGATAGGTGGGACCATATATTAGTAGTAAAGTAATCAACTATTATATAAATTG[G/A]
CTATTAGATTGACTATAGATAAATTGGAGCTAATAGTGGGCTATAATATTAAACTTCTCTTAAGATCAACGATTGGTGTCACTTGGTTGGGTACACGTAC

Reverse complement sequence

GTACGTGTACCCAACCAAGTGACACCAATCGTTGATCTTAAGAGAAGTTTAATATTATAGCCCACTATTAGCTCCAATTTATCTATAGTCAATCTAATAG[C/T]
CAATTTATATAATAGTTGATTACTTTACTACTAATATATGGTCCCACCTATCATATACACATTATGTCTTGGAATCCGTGCTGTAGCTGGCTACATATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.30% 0.23% 0.00% NA
All Indica  2759 82.80% 16.90% 0.36% 0.00% NA
All Japonica  1512 98.40% 1.50% 0.07% 0.00% NA
Aus  269 34.90% 65.10% 0.00% 0.00% NA
Indica I  595 89.90% 9.90% 0.17% 0.00% NA
Indica II  465 47.30% 51.60% 1.08% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 83.70% 15.80% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626324304 G -> A LOC_Os06g43740.1 upstream_gene_variant ; 211.0bp to feature; MODIFIER silent_mutation Average:80.639; most accessible tissue: Callus, score: 96.666 N N N N
vg0626324304 G -> A LOC_Os06g43720.1 downstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:80.639; most accessible tissue: Callus, score: 96.666 N N N N
vg0626324304 G -> A LOC_Os06g43730.1 downstream_gene_variant ; 2745.0bp to feature; MODIFIER silent_mutation Average:80.639; most accessible tissue: Callus, score: 96.666 N N N N
vg0626324304 G -> A LOC_Os06g43750.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:80.639; most accessible tissue: Callus, score: 96.666 N N N N
vg0626324304 G -> A LOC_Os06g43740-LOC_Os06g43750 intergenic_region ; MODIFIER silent_mutation Average:80.639; most accessible tissue: Callus, score: 96.666 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626324304 G A -0.02 -0.06 -0.07 -0.04 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626324304 NA 8.51E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 5.43E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 6.06E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 2.36E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 8.11E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 2.37E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 3.89E-10 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 2.05E-08 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 9.50E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 8.39E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 3.41E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 3.08E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 1.84E-07 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626324304 NA 6.75E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251