\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626322631:

Variant ID: vg0626322631 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26322631
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGGTTAGATTGAAGGGTGACTCGGCACAAACAAGTGCTCTACACAATAATAATATCCTCTTCGTATCTAAATATTTGGCACCGTTGACTTTCTTAAA[C/T]
ATGTTGAACAGTTTGTCTTATTAAAAAATTTTAAATAATTATTAGTTCCTTTCCTATAATTTGATTCATTGTTAAATATACTTTTACGTATACATATAGT

Reverse complement sequence

ACTATATGTATACGTAAAAGTATATTTAACAATGAATCAAATTATAGGAAAGGAACTAATAATTATTTAAAATTTTTTAATAAGACAAACTGTTCAACAT[G/A]
TTTAAGAAAGTCAACGGTGCCAAATATTTAGATACGAAGAGGATATTATTATTGTGTAGAGCACTTGTTTGTGCCGAGTCACCCTTCAATCTAACCTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.90% 0.15% 0.00% NA
All Indica  2759 77.60% 22.40% 0.07% 0.00% NA
All Japonica  1512 2.70% 97.20% 0.13% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 90.10% 9.90% 0.00% 0.00% NA
Indica II  465 40.90% 59.10% 0.00% 0.00% NA
Indica III  913 88.10% 11.80% 0.11% 0.00% NA
Indica Intermediate  786 77.60% 22.30% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 6.70% 93.10% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626322631 C -> T LOC_Os06g43710.1 upstream_gene_variant ; 3675.0bp to feature; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0626322631 C -> T LOC_Os06g43720.1 downstream_gene_variant ; 2448.0bp to feature; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0626322631 C -> T LOC_Os06g43730.1 downstream_gene_variant ; 1072.0bp to feature; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0626322631 C -> T LOC_Os06g43740.1 downstream_gene_variant ; 197.0bp to feature; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0626322631 C -> T LOC_Os06g43750.1 downstream_gene_variant ; 3536.0bp to feature; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0626322631 C -> T LOC_Os06g43730-LOC_Os06g43740 intergenic_region ; MODIFIER silent_mutation Average:50.227; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626322631 NA 2.76E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 2.57E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.35E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 4.43E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.88E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 4.48E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.46E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 6.98E-11 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.11E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.61E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 2.85E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 9.75E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.56E-11 mr1442 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 2.97E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 4.76E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.13E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 6.38E-07 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.08E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.82E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 7.58E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.24E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.90E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.70E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.28E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 9.42E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 2.01E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 2.28E-08 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 3.96E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 1.40E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 8.00E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626322631 NA 8.04E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251