\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626321316:

Variant ID: vg0626321316 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26321316
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACAATGTGTACTGCTCTGTCGGTCCACCAATCCGCCGTCATGTCCACAGAGGTTGTGGGGGAGCATGAGGAGGGGCTAGCTCTGCGACTCTACTCCCG[A/G]
GACTTCTTGCCGAAGGAGCAGGGACAACACCATAGCTATAGGTCCCTCGTGCTGGCCCGCCTCCAACGTGACTCGGCGTGCGCCGTGGCGATGTCGGCCC

Reverse complement sequence

GGGCCGACATCGCCACGGCGCACGCCGAGTCACGTTGGAGGCGGGCCAGCACGAGGGACCTATAGCTATGGTGTTGTCCCTGCTCCTTCGGCAAGAAGTC[T/C]
CGGGAGTAGAGTCGCAGAGCTAGCCCCTCCTCATGCTCCCCCACAACCTCTGTGGACATGACGGCGGATTGGTGGACCGACAGAGCAGTACACATTGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 14.10% 1.82% 10.60% NA
All Indica  2759 80.90% 0.40% 0.83% 17.83% NA
All Japonica  1512 53.90% 42.00% 4.03% 0.07% NA
Aus  269 98.10% 0.00% 0.37% 1.49% NA
Indica I  595 90.40% 0.00% 0.50% 9.08% NA
Indica II  465 46.70% 1.30% 2.15% 49.89% NA
Indica III  913 89.30% 0.20% 0.33% 10.19% NA
Indica Intermediate  786 84.40% 0.40% 0.89% 14.38% NA
Temperate Japonica  767 27.60% 66.40% 5.87% 0.13% NA
Tropical Japonica  504 82.90% 15.70% 1.39% 0.00% NA
Japonica Intermediate  241 76.80% 19.50% 3.73% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 84.40% 10.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626321316 A -> G LOC_Os06g43730.1 synonymous_variant ; p.Arg20Arg; LOW synonymous_codon Average:40.937; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0626321316 A -> DEL LOC_Os06g43730.1 N frameshift_variant Average:40.937; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626321316 A G 0.02 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626321316 NA 5.31E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 3.94E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 1.76E-07 1.46E-16 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 3.69E-10 mr1182 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 2.91E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 7.88E-08 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 2.09E-06 1.48E-14 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 2.03E-08 mr1650 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 5.02E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 3.27E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 6.17E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 1.17E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 8.54E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 4.17E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 1.78E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 1.79E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 1.47E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 2.25E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 2.23E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 8.06E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 6.75E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 8.08E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626321316 NA 1.57E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251