Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626226028:

Variant ID: vg0626226028 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26226028
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGTTCCTTATTAATATTCATGAGGGATTTTTCAGGGAGGGGGAGAGGAACAGCGAGCGTTGTACGTTGGGAGAAGTGTTGCCCCATGCGATGCCCTCA[T/C]
AACCCGTTGGAGCCAGCGACGATGAGCTGATTCGAGGTGGTGGCGGTCGTCCCGAGTTGCTCCACTCGTGGTTGTCACTGATCGAGGCAAGCCCAATGCC

Reverse complement sequence

GGCATTGGGCTTGCCTCGATCAGTGACAACCACGAGTGGAGCAACTCGGGACGACCGCCACCACCTCGAATCAGCTCATCGTCGCTGGCTCCAACGGGTT[A/G]
TGAGGGCATCGCATGGGGCAACACTTCTCCCAACGTACAACGCTCGCTGTTCCTCTCCCCCTCCCTGAAAAATCCCTCATGAATATTAATAAGGAACTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	12.40%	0.40%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	60.80%	38.00%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	36.40%	61.30%	2.35%	0.00%	NA
Tropical Japonica	504	91.50%	8.50%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	25.30%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626226028	T -> C	LOC_Os06g43600.1	upstream_gene_variant ; 1076.0bp to feature; MODIFIER	silent_mutation	Average:61.619; most accessible tissue: Callus, score: 73.127	N	N	N	N
vg0626226028	T -> C	LOC_Os06g43600.2	upstream_gene_variant ; 1076.0bp to feature; MODIFIER	silent_mutation	Average:61.619; most accessible tissue: Callus, score: 73.127	N	N	N	N
vg0626226028	T -> C	LOC_Os06g43610.1	downstream_gene_variant ; 3829.0bp to feature; MODIFIER	silent_mutation	Average:61.619; most accessible tissue: Callus, score: 73.127	N	N	N	N
vg0626226028	T -> C	LOC_Os06g43590-LOC_Os06g43600	intergenic_region ; MODIFIER	silent_mutation	Average:61.619; most accessible tissue: Callus, score: 73.127	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626226028	5.83E-06	7.66E-15	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	8.01E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.17E-12	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	7.19E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	5.51E-14	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	2.13E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.54E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.94E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	1.26E-06	1.01E-18	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	3.49E-15	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.15E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.37E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	2.30E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	4.67E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	8.06E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	2.44E-09	3.66E-28	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	1.57E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028	NA	7.34E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251