\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626226028:

Variant ID: vg0626226028 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26226028
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGTTCCTTATTAATATTCATGAGGGATTTTTCAGGGAGGGGGAGAGGAACAGCGAGCGTTGTACGTTGGGAGAAGTGTTGCCCCATGCGATGCCCTCA[T/C]
AACCCGTTGGAGCCAGCGACGATGAGCTGATTCGAGGTGGTGGCGGTCGTCCCGAGTTGCTCCACTCGTGGTTGTCACTGATCGAGGCAAGCCCAATGCC

Reverse complement sequence

GGCATTGGGCTTGCCTCGATCAGTGACAACCACGAGTGGAGCAACTCGGGACGACCGCCACCACCTCGAATCAGCTCATCGTCGCTGGCTCCAACGGGTT[A/G]
TGAGGGCATCGCATGGGGCAACACTTCTCCCAACGTACAACGCTCGCTGTTCCTCTCCCCCTCCCTGAAAAATCCCTCATGAATATTAATAAGGAACTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 12.40% 0.40% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 60.80% 38.00% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 36.40% 61.30% 2.35% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.30% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626226028 T -> C LOC_Os06g43600.1 upstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:61.619; most accessible tissue: Callus, score: 73.127 N N N N
vg0626226028 T -> C LOC_Os06g43600.2 upstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:61.619; most accessible tissue: Callus, score: 73.127 N N N N
vg0626226028 T -> C LOC_Os06g43610.1 downstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:61.619; most accessible tissue: Callus, score: 73.127 N N N N
vg0626226028 T -> C LOC_Os06g43590-LOC_Os06g43600 intergenic_region ; MODIFIER silent_mutation Average:61.619; most accessible tissue: Callus, score: 73.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626226028 5.83E-06 7.66E-15 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 8.01E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.17E-12 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 7.19E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 5.51E-14 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 2.13E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.54E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.94E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 1.26E-06 1.01E-18 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 3.49E-15 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.15E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.37E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 2.30E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 4.67E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 8.06E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 2.44E-09 3.66E-28 mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 1.57E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626226028 NA 7.34E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251