\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626212220:

Variant ID: vg0626212220 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26212220
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCTTCCATTTAGAACACCAAAGAACTGGTTAAAATTACCTGCAATTGGTGCTAAATTAAGGCACGTGTTGAGATATTTTCAGCAAAGAAAATCAAGCA[G/C]
TGTCTTCCCTAGGATCATTGGTTCTCTTTAGATCTTTCGTTGAACTTGTAGAGAGGAAAATACCCAAGTAGGATGCATGCATGCATGCCTGCAGGCGAGT

Reverse complement sequence

ACTCGCCTGCAGGCATGCATGCATGCATCCTACTTGGGTATTTTCCTCTCTACAAGTTCAACGAAAGATCTAAAGAGAACCAATGATCCTAGGGAAGACA[C/G]
TGCTTGATTTTCTTTGCTGAAAATATCTCAACACGTGCCTTAATTTAGCACCAATTGCAGGTAATTTTAACCAGTTCTTTGGTGTTCTAAATGGAAGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 9.40% 6.83% 0.02% NA
All Indica  2759 99.30% 0.50% 0.25% 0.00% NA
All Japonica  1512 53.50% 27.10% 19.31% 0.07% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 1.50% 0.86% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 65.30% 20.90% 13.69% 0.13% NA
Tropical Japonica  504 34.30% 38.30% 27.38% 0.00% NA
Japonica Intermediate  241 56.00% 23.70% 20.33% 0.00% NA
VI/Aromatic  96 72.90% 13.50% 13.54% 0.00% NA
Intermediate  90 84.40% 5.60% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626212220 G -> C LOC_Os06g43590.2 upstream_gene_variant ; 3262.0bp to feature; MODIFIER silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N
vg0626212220 G -> C LOC_Os06g43590.3 upstream_gene_variant ; 3280.0bp to feature; MODIFIER silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N
vg0626212220 G -> C LOC_Os06g43590.4 upstream_gene_variant ; 3280.0bp to feature; MODIFIER silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N
vg0626212220 G -> C LOC_Os06g43580.1 downstream_gene_variant ; 219.0bp to feature; MODIFIER silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N
vg0626212220 G -> C LOC_Os06g43580-LOC_Os06g43590 intergenic_region ; MODIFIER silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N
vg0626212220 G -> DEL N N silent_mutation Average:27.425; most accessible tissue: Callus, score: 67.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626212220 8.28E-08 NA mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626212220 NA 2.53E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251