Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626212220:

Variant ID: vg0626212220 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26212220
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCTTCCATTTAGAACACCAAAGAACTGGTTAAAATTACCTGCAATTGGTGCTAAATTAAGGCACGTGTTGAGATATTTTCAGCAAAGAAAATCAAGCA[G/C]
TGTCTTCCCTAGGATCATTGGTTCTCTTTAGATCTTTCGTTGAACTTGTAGAGAGGAAAATACCCAAGTAGGATGCATGCATGCATGCCTGCAGGCGAGT

Reverse complement sequence

ACTCGCCTGCAGGCATGCATGCATGCATCCTACTTGGGTATTTTCCTCTCTACAAGTTCAACGAAAGATCTAAAGAGAACCAATGATCCTAGGGAAGACA[C/G]
TGCTTGATTTTCTTTGCTGAAAATATCTCAACACGTGCCTTAATTTAGCACCAATTGCAGGTAATTTTAACCAGTTCTTTGGTGTTCTAAATGGAAGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	9.40%	6.83%	0.02%	NA
All Indica	2759	99.30%	0.50%	0.25%	0.00%	NA
All Japonica	1512	53.50%	27.10%	19.31%	0.07%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	1.50%	0.86%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.40%	0.25%	0.00%	NA
Temperate Japonica	767	65.30%	20.90%	13.69%	0.13%	NA
Tropical Japonica	504	34.30%	38.30%	27.38%	0.00%	NA
Japonica Intermediate	241	56.00%	23.70%	20.33%	0.00%	NA
VI/Aromatic	96	72.90%	13.50%	13.54%	0.00%	NA
Intermediate	90	84.40%	5.60%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626212220	G -> C	LOC_Os06g43590.2	upstream_gene_variant ; 3262.0bp to feature; MODIFIER	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N
vg0626212220	G -> C	LOC_Os06g43590.3	upstream_gene_variant ; 3280.0bp to feature; MODIFIER	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N
vg0626212220	G -> C	LOC_Os06g43590.4	upstream_gene_variant ; 3280.0bp to feature; MODIFIER	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N
vg0626212220	G -> C	LOC_Os06g43580.1	downstream_gene_variant ; 219.0bp to feature; MODIFIER	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N
vg0626212220	G -> C	LOC_Os06g43580-LOC_Os06g43590	intergenic_region ; MODIFIER	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N
vg0626212220	G -> DEL	N	N	silent_mutation	Average:27.425; most accessible tissue: Callus, score: 67.566	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626212220	8.28E-08	NA	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626212220	NA	2.53E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251