Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626149778:

Variant ID: vg0626149778 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26149778
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTATTATTATTATCATTATTATTATTATTATTATTACAAATGGAAGTATAACTTTCGGTCTATGCATCAACCAAGAATACACACAGCCATATTTCGG[T/A]
AGGATTTCAACTTGGTAAATAAAGTCACCACATCGATGGTAGATTTGCAAATTTCAATCAGTCAAGAGCGGATCTAGCGTGGGACGGTGGGGGCTCGAGA

Reverse complement sequence

TCTCGAGCCCCCACCGTCCCACGCTAGATCCGCTCTTGACTGATTGAAATTTGCAAATCTACCATCGATGTGGTGACTTTATTTACCAAGTTGAAATCCT[A/T]
CCGAAATATGGCTGTGTGTATTCTTGGTTGATGCATAGACCGAAAGTTATACTTCCATTTGTAATAATAATAATAATAATAATGATAATAATAATAATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	2.10%	3.26%	0.00%	NA
All Indica	2759	90.90%	3.60%	5.44%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	70.80%	10.40%	18.82%	0.00%	NA
Indica II	465	95.70%	2.40%	1.94%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	3.40%	3.69%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626149778	T -> A	LOC_Os06g43490.1	downstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:41.639; most accessible tissue: Callus, score: 74.222	N	N	N	N
vg0626149778	T -> A	LOC_Os06g43500.1	downstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:41.639; most accessible tissue: Callus, score: 74.222	N	N	N	N
vg0626149778	T -> A	LOC_Os06g43490-LOC_Os06g43500	intergenic_region ; MODIFIER	silent_mutation	Average:41.639; most accessible tissue: Callus, score: 74.222	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626149778	7.96E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0626149778	1.50E-06	NA	Plant_height	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0626149778	NA	7.67E-07	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0626149778	NA	7.26E-08	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	5.13E-06	6.92E-06	mr1159_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	6.58E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	8.65E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	7.75E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	3.02E-06	4.04E-06	mr1445_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	2.94E-06	3.62E-06	mr1445_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	8.61E-06	NA	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	5.22E-06	2.55E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	2.24E-06	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	4.97E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	7.43E-06	6.82E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	8.05E-06	8.08E-06	mr1651_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	4.46E-07	4.46E-07	mr1651_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	9.73E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	3.39E-06	3.39E-06	mr1821_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	NA	1.02E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626149778	4.34E-06	6.79E-06	mr1977_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251