\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626092352:

Variant ID: vg0626092352 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26092352
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGTCGCATATATGCTTGCGTGCGCGCTTCATGCATGTCAATAACTTAGTATACCATACTAATCTATGTAATGAACCCAATCGTCTTGGAACAGCTCT[C/A]
GCCATGGACGCCTTCGTGCATACAAGATAATCTTGTTTTTGTTCTTGATAATCTTGTTTTATCCAAGATTAGATAGTACTACTAGTAATGAGGTAGTATA

Reverse complement sequence

TATACTACCTCATTACTAGTAGTACTATCTAATCTTGGATAAAACAAGATTATCAAGAACAAAAACAAGATTATCTTGTATGCACGAAGGCGTCCATGGC[G/T]
AGAGCTGTTCCAAGACGATTGGGTTCATTACATAGATTAGTATGGTATACTAAGTTATTGACATGCATGAAGCGCGCACGCAAGCATATATGCGACATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 0.30% 20.44% 4.25% NA
All Indica  2759 61.00% 0.40% 31.71% 6.81% NA
All Japonica  1512 99.70% 0.00% 0.20% 0.13% NA
Aus  269 69.50% 0.70% 26.39% 3.35% NA
Indica I  595 36.30% 0.00% 47.73% 15.97% NA
Indica II  465 44.70% 0.00% 47.31% 7.96% NA
Indica III  913 80.70% 1.00% 17.09% 1.20% NA
Indica Intermediate  786 66.50% 0.40% 27.35% 5.73% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 0.00% 7.29% 2.08% NA
Intermediate  90 88.90% 0.00% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626092352 C -> A LOC_Os06g43410.1 upstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:87.807; most accessible tissue: Zhenshan97 root, score: 98.334 N N N N
vg0626092352 C -> A LOC_Os06g43420.1 downstream_gene_variant ; 4802.0bp to feature; MODIFIER silent_mutation Average:87.807; most accessible tissue: Zhenshan97 root, score: 98.334 N N N N
vg0626092352 C -> A LOC_Os06g43384-LOC_Os06g43410 intergenic_region ; MODIFIER silent_mutation Average:87.807; most accessible tissue: Zhenshan97 root, score: 98.334 N N N N
vg0626092352 C -> DEL N N silent_mutation Average:87.807; most accessible tissue: Zhenshan97 root, score: 98.334 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626092352 C A 0.03 0.0 0.03 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626092352 3.37E-06 NA mr1327 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 4.07E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 7.52E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 8.57E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 9.77E-09 mr1349_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 4.01E-06 2.35E-07 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 4.60E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 7.52E-06 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 8.45E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 3.55E-06 mr1462_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 2.88E-06 2.11E-07 mr1470_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 3.37E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 6.02E-07 mr1719_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 1.56E-08 4.00E-09 mr1761_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626092352 NA 8.04E-08 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251