Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0626066579:

Variant ID: vg0626066579 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26066579
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGAGAGGAAGGGGATGAAGGGGAGAGGAAGGGATGGAGAGGAAATATTAATGAGAGGGGAGAGGAGATCGAGAGGAGAGCGGATAAAGATGGCGCGC[A/G]
CGGCTCGAGGTGCTCTTTCCTCCCGGTTGGTATAAACAACCGGGACTAAAAATAGATCTTTAGTCCCAGTTGTTTATACCAACGGGGAGTAAAAATAGTT

Reverse complement sequence

AACTATTTTTACTCCCCGTTGGTATAAACAACTGGGACTAAAGATCTATTTTTAGTCCCGGTTGTTTATACCAACCGGGAGGAAAGAGCACCTCGAGCCG[T/C]
GCGCGCCATCTTTATCCGCTCTCCTCTCGATCTCCTCTCCCCTCTCATTAATATTTCCTCTCCATCCCTTCCTCTCCCCTTCATCCCCTTCCTCTCCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 29.00% 0.02% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 14.40% 85.60% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 26.00% 73.80% 0.20% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626066579 A -> G LOC_Os06g43360.1 upstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:51.534; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0626066579 A -> G LOC_Os06g43350.1 downstream_gene_variant ; 1222.0bp to feature; MODIFIER silent_mutation Average:51.534; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0626066579 A -> G LOC_Os06g43350-LOC_Os06g43360 intergenic_region ; MODIFIER silent_mutation Average:51.534; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626066579 NA 4.95E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 2.73E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.27E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 8.97E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 3.45E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.90E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.35E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 4.84E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.86E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 3.34E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 3.12E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 7.57E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.13E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 9.72E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 7.82E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.75E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 9.55E-10 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.53E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 5.86E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 7.17E-06 7.17E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 2.17E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 8.34E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 1.05E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 5.31E-07 NA mr1851_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 5.42E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626066579 NA 3.32E-50 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251