Search for Variation information by Variation ID:
Detailed information for vg0626053134:
| Variant ID: vg0626053134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26053134 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 89. )
Flanking Sequence (100 bp) in Reference Genome:
GAGAAAAGTGCCAGGCTCGAGCGATTCTCGTCTGAACGCACGTTGTGCTAGGTCGTCTGGCTCAATGTTGTCCTTGCGGTAGACGTGTCGGACCTCGATC[G/C,A]
CATCGAACCTTTTCTCTAGCTTCCTGACTTCTGCAAGATACTTGGATAACTCGGGGTTAGAGCATTTATAATCTTTGTGCACCTGGTTCGCGACTAGCTC
Reverse complement sequence
GAGCTAGTCGCGAACCAGGTGCACAAAGATTATAAATGCTCTAACCCCGAGTTATCCAAGTATCTTGCAGAAGTCAGGAAGCTAGAGAAAAGGTTCGATG[C/G,T]
GATCGAGGTCCGACACGTCTACCGCAAGGACAACATTGAGCCAGACGACCTAGCACAACGTGCGTTCAGACGAGAATCGCTCGAGCCTGGCACTTTTCTC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 19.00% | 21.92% | 19.17% | A: 0.15% |
| All Indica | 2759 | 5.60% | 31.50% | 35.45% | 27.47% | NA |
| All Japonica | 1512 | 98.90% | 0.10% | 0.53% | 0.46% | NA |
| Aus | 269 | 52.80% | 1.50% | 9.67% | 36.06% | NA |
| Indica I | 595 | 4.50% | 37.00% | 19.83% | 38.66% | NA |
| Indica II | 465 | 8.40% | 42.80% | 22.58% | 26.24% | NA |
| Indica III | 913 | 2.20% | 19.60% | 54.98% | 23.22% | NA |
| Indica Intermediate | 786 | 8.80% | 34.40% | 32.19% | 24.68% | NA |
| Temperate Japonica | 767 | 98.70% | 0.10% | 0.78% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 16.70% | 12.50% | 22.92% | A: 6.25% |
| Intermediate | 90 | 50.00% | 11.10% | 13.33% | 24.44% | A: 1.11% |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626053134 | G -> C | LOC_Os06g43340.1 | missense_variant ; p.Ala1323Gly; MODERATE | nonsynonymous_codon ; A1323G | Average:10.204; most accessible tissue: Callus, score: 19.254 | benign  |
-0.863 |
TOLERATED | 1.00 |
| vg0626053134 | G -> A | LOC_Os06g43340.1 | missense_variant ; p.Ala1323Val; MODERATE | nonsynonymous_codon ; A1323V | Average:10.204; most accessible tissue: Callus, score: 19.254 | benign |
1.394 |
DELETERIOUS | 0.00 |
| vg0626053134 | G -> DEL | LOC_Os06g43340.1 | N | frameshift_variant | Average:10.204; most accessible tissue: Callus, score: 19.254 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626053134 | NA | 3.81E-38 | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 9.92E-42 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 7.48E-41 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 2.30E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 1.30E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 1.94E-25 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 4.02E-60 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 5.44E-58 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | 3.75E-06 | 3.58E-09 | mr1072_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | 6.99E-06 | 1.05E-08 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 3.57E-54 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626053134 | NA | 6.66E-08 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |