| Variant ID: vg0626047468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26047468 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTTGGTTCGACTAGATCTCGATGGCTTGGCTCCTTGCAGGCTCCGGCTTCGTAGGCTGTGTGGGTTGTGTTGGCTCTGAGATTCGATGCCTTAAGCCCTC[A/C]
CCGGGGGGTCCCTTTTATATCACAGATCTGGAGGTCTCCAAGTAGAACTAGGAGATATCAGACCCTATTCGATACGTTAATGACCCAGTCTTGTCCGAGT
ACTCGGACAAGACTGGGTCATTAACGTATCGAATAGGGTCTGATATCTCCTAGTTCTACTTGGAGACCTCCAGATCTGTGATATAAAAGGGACCCCCCGG[T/G]
GAGGGCTTAAGGCATCGAATCTCAGAGCCAACACAACCCACACAGCCTACGAAGCCGGAGCCTGCAAGGAGCCAAGCCATCGAGATCTAGTCGAACCAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 0.40% | 4.82% | 54.10% | NA |
| All Indica | 2759 | 5.80% | 0.60% | 7.90% | 85.68% | NA |
| All Japonica | 1512 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Aus | 269 | 52.80% | 0.00% | 0.37% | 46.84% | NA |
| Indica I | 595 | 3.40% | 0.80% | 9.92% | 85.88% | NA |
| Indica II | 465 | 8.20% | 1.10% | 9.46% | 81.29% | NA |
| Indica III | 913 | 2.80% | 0.30% | 5.37% | 91.46% | NA |
| Indica Intermediate | 786 | 9.70% | 0.50% | 8.40% | 81.42% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 5.21% | 25.00% | NA |
| Intermediate | 90 | 56.70% | 1.10% | 4.44% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626047468 | A -> C | LOC_Os06g43330.1 | upstream_gene_variant ; 692.0bp to feature; MODIFIER | silent_mutation | Average:26.069; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0626047468 | A -> C | LOC_Os06g43340.1 | downstream_gene_variant ; 4591.0bp to feature; MODIFIER | silent_mutation | Average:26.069; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0626047468 | A -> C | LOC_Os06g43320-LOC_Os06g43330 | intergenic_region ; MODIFIER | silent_mutation | Average:26.069; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0626047468 | A -> DEL | N | N | silent_mutation | Average:26.069; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626047468 | 5.60E-06 | 5.60E-06 | mr1302 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626047468 | NA | 1.82E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626047468 | NA | 2.32E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626047468 | 5.70E-06 | 5.70E-06 | mr1824 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626047468 | NA | 1.62E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |