\
| Variant ID: vg0626022065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26022065 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 277. )
GCTTCGTACGACTGCTCCCTGTTCGATCACAACGGCTTGTTTTCCTTTTCGCTTGCGTGCTGCGCGCCGTCGTTAAAGCCCGCAACCGCGAGTCTTTCCT[G/A]
CTAAGCAGCCGGTTTTCCGATACCCTCAGTATGTGTTCAACATATTACGCATATTTGGTCTGTTCATTCTTTACTGTCTAGTTTACATGTGTAGATTTTA
TAAAATCTACACATGTAAACTAGACAGTAAAGAATGAACAGACCAAATATGCGTAATATGTTGAACACATACTGAGGGTATCGGAAAACCGGCTGCTTAG[C/T]
AGGAAAGACTCGCGGTTGCGGGCTTTAACGACGGCGCGCAGCACGCAAGCGAAAAGGAAAACAAGCCGTTGTGATCGAACAGGGAGCAGTCGTACGAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 2.30% | 0.91% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 7.10% | 2.78% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.20% | 11.00% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 9.50% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626022065 | G -> A | LOC_Os06g43304.1 | upstream_gene_variant ; 202.0bp to feature; MODIFIER | silent_mutation | Average:60.45; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0626022065 | G -> A | LOC_Os06g43290-LOC_Os06g43304 | intergenic_region ; MODIFIER | silent_mutation | Average:60.45; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626022065 | NA | 1.10E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 3.24E-06 | mr1007 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 1.94E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 1.71E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 1.98E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 2.02E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | 1.82E-07 | 1.82E-07 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 7.60E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 3.88E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 2.70E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 5.00E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 4.72E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 3.78E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 3.52E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626022065 | NA | 4.61E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |