\
| Variant ID: vg0625951448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25951448 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTAAGAAACATCATTGATATATACTTCCTCCGTTTCGAAATGTTTGACACCGTTGACTTTTTAACACATGTTTGACCGTTCGTCTTATTCAAAAACTTT[T/G]
ATGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGAC
GTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCAT[A/C]
AAAGTTTTTGAATAAGACGAACGGTCAAACATGTGTTAAAAAGTCAACGGTGTCAAACATTTCGAAACGGAGGAAGTATATATCAATGATGTTTCTTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.40% | 3.60% | 2.52% | 61.49% | NA |
| All Indica | 2759 | 3.90% | 0.00% | 0.65% | 95.40% | NA |
| All Japonica | 1512 | 86.00% | 11.30% | 1.46% | 1.26% | NA |
| Aus | 269 | 5.60% | 0.00% | 25.65% | 68.77% | NA |
| Indica I | 595 | 1.70% | 0.00% | 0.50% | 97.82% | NA |
| Indica II | 465 | 6.90% | 0.20% | 0.00% | 92.90% | NA |
| Indica III | 913 | 1.00% | 0.00% | 0.33% | 98.69% | NA |
| Indica Intermediate | 786 | 7.30% | 0.00% | 1.53% | 91.22% | NA |
| Temperate Japonica | 767 | 78.50% | 20.20% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 94.00% | 0.20% | 3.77% | 1.98% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 0.00% | 4.17% | 31.25% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 6.67% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625951448 | T -> G | LOC_Os06g43170.1 | upstream_gene_variant ; 1903.0bp to feature; MODIFIER | silent_mutation | Average:55.253; most accessible tissue: Zhenshan97 root, score: 86.685 | N | N | N | N |
| vg0625951448 | T -> G | LOC_Os06g43170-LOC_Os06g43180 | intergenic_region ; MODIFIER | silent_mutation | Average:55.253; most accessible tissue: Zhenshan97 root, score: 86.685 | N | N | N | N |
| vg0625951448 | T -> DEL | N | N | silent_mutation | Average:55.253; most accessible tissue: Zhenshan97 root, score: 86.685 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625951448 | NA | 2.26E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 7.20E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 6.19E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 2.10E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 7.42E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | 2.03E-06 | 2.03E-06 | mr1370 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 7.92E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 6.60E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 1.40E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 5.52E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 6.67E-07 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | 7.14E-07 | 1.62E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | 2.86E-06 | 2.86E-06 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 9.67E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 7.62E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625951448 | NA | 6.91E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |