\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625950834:

Variant ID: vg0625950834 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25950834
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTAGGATATGTTTAGTTCCCTTTAAACTTCTAAAAATTTCGTCACATTTAATGATTGGACACATGTATGGAGCATTAAATGTGGACGGAAAAAACCA[A/G]
TTGCACAGTTTGCATGTAAATTGTGAGACAAATCTTTTAAGTCTAATTATGCCATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATGACGGAT

Reverse complement sequence

ATCCGTCATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGGCATAATTAGACTTAAAAGATTTGTCTCACAATTTACATGCAAACTGTGCAA[T/C]
TGGTTTTTTCCGTCCACATTTAATGCTCCATACATGTGTCCAATCATTAAATGTGACGAAATTTTTAGAAGTTTAAAGGGAACTAAACATATCCTAAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 5.90% 1.65% 0.00% NA
All Indica  2759 87.60% 9.70% 2.65% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 92.40% 3.50% 4.03% 0.00% NA
Indica II  465 56.30% 37.00% 6.67% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 88.40% 9.40% 2.16% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625950834 A -> G LOC_Os06g43170.1 upstream_gene_variant ; 1289.0bp to feature; MODIFIER silent_mutation Average:53.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625950834 A -> G LOC_Os06g43170-LOC_Os06g43180 intergenic_region ; MODIFIER silent_mutation Average:53.957; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625950834 NA 5.51E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 2.82E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 7.18E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 1.38E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 1.70E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 4.93E-08 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 4.70E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 5.78E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 1.18E-08 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 1.93E-06 1.93E-06 mr1819 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 2.88E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 8.72E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 3.36E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 2.43E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 4.88E-06 mr1893_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625950834 NA 7.41E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251