Variant ID: vg0625912245 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 25912245 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )
GATCGCCATTTTCCGCTGCTGCTGCTTTTGTTTTGGTGTGAGGACTAAGTGCCTCTTCTGTAAGTATTTTACGCTTTATTTACGTTTGGAACTGTATATT[A/G]
CTTGTCGTTTTGTGTACCCTGGCTGGTCCTAGACAGGGATTTAATACACAAAATAGTCTAGAAATTTGGGCTAAATTTCTGGGCGTGACACCCCTATCCA
TGGATAGGGGTGTCACGCCCAGAAATTTAGCCCAAATTTCTAGACTATTTTGTGTATTAAATCCCTGTCTAGGACCAGCCAGGGTACACAAAACGACAAG[T/C]
AATATACAGTTCCAAACGTAAATAAAGCGTAAAATACTTACAGAAGAGGCACTTAGTCCTCACACCAAAACAAAAGCAGCAGCAGCGGAAAATGGCGATC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.00% | 3.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 90.70% | 9.20% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 83.10% | 16.80% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0625912245 | A -> G | LOC_Os06g43100.1 | upstream_gene_variant ; 4924.0bp to feature; MODIFIER | silent_mutation | Average:34.802; most accessible tissue: Callus, score: 63.713 | N | N | N | N |
vg0625912245 | A -> G | LOC_Os06g43110.1 | upstream_gene_variant ; 2444.0bp to feature; MODIFIER | silent_mutation | Average:34.802; most accessible tissue: Callus, score: 63.713 | N | N | N | N |
vg0625912245 | A -> G | LOC_Os06g43110-LOC_Os06g43120 | intergenic_region ; MODIFIER | silent_mutation | Average:34.802; most accessible tissue: Callus, score: 63.713 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0625912245 | NA | 9.91E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | NA | 8.08E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | NA | 1.26E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | NA | 1.34E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | NA | 1.53E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | NA | 3.32E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | 2.36E-09 | 7.71E-13 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | 5.06E-07 | 5.07E-07 | mr1317_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | 1.26E-06 | 5.33E-07 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | 1.29E-06 | 2.56E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0625912245 | 6.07E-06 | 6.07E-06 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |