\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625912245:

Variant ID: vg0625912245 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25912245
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GATCGCCATTTTCCGCTGCTGCTGCTTTTGTTTTGGTGTGAGGACTAAGTGCCTCTTCTGTAAGTATTTTACGCTTTATTTACGTTTGGAACTGTATATT[A/G]
CTTGTCGTTTTGTGTACCCTGGCTGGTCCTAGACAGGGATTTAATACACAAAATAGTCTAGAAATTTGGGCTAAATTTCTGGGCGTGACACCCCTATCCA

Reverse complement sequence

TGGATAGGGGTGTCACGCCCAGAAATTTAGCCCAAATTTCTAGACTATTTTGTGTATTAAATCCCTGTCTAGGACCAGCCAGGGTACACAAAACGACAAG[T/C]
AATATACAGTTCCAAACGTAAATAAAGCGTAAAATACTTACAGAAGAGGCACTTAGTCCTCACACCAAAACAAAAGCAGCAGCAGCGGAAAATGGCGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 3.00% 0.02% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.70% 9.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 83.10% 16.80% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625912245 A -> G LOC_Os06g43100.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:34.802; most accessible tissue: Callus, score: 63.713 N N N N
vg0625912245 A -> G LOC_Os06g43110.1 upstream_gene_variant ; 2444.0bp to feature; MODIFIER silent_mutation Average:34.802; most accessible tissue: Callus, score: 63.713 N N N N
vg0625912245 A -> G LOC_Os06g43110-LOC_Os06g43120 intergenic_region ; MODIFIER silent_mutation Average:34.802; most accessible tissue: Callus, score: 63.713 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625912245 NA 9.91E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 NA 8.08E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 NA 1.26E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 NA 1.34E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 NA 1.53E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 NA 3.32E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 2.36E-09 7.71E-13 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 5.06E-07 5.07E-07 mr1317_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 1.26E-06 5.33E-07 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 1.29E-06 2.56E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625912245 6.07E-06 6.07E-06 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251