Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625656832:

Variant ID: vg0625656832 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 25656832
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGATTTTAGTGTGGTTACCGTGAAAATGGGCAAAATTTGGTTATGTTTGGCTGAAAATTTTAATGGTAAAATTTGGGTAAGCTCGTGTGTGTTTTTTT[T/A,TA]
AAAAAAATTGTGTTCTCTAAAAGACTTTGTTATGTTTTAGGCTTTCTGAAAAGCCGGGTCGATCATCTTGAAAACGAATTAAGAGCAAAAATTGCCAAAA

Reverse complement sequence

TTTTGGCAATTTTTGCTCTTAATTCGTTTTCAAGATGATCGACCCGGCTTTTCAGAAAGCCTAAAACATAACAAAGTCTTTTAGAGAACACAATTTTTTT[A/T,TA]
AAAAAAACACACACGAGCTTACCCAAATTTTACCATTAAAATTTTCAGCCAAACATAACCAAATTTTGCCCATTTTCACGGTAACCACACTAAAATCAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	28.70%	0.32%	0.00%	TA: 0.25%
All Indica	2759	97.20%	2.70%	0.07%	0.00%	TA: 0.04%
All Japonica	1512	25.60%	73.50%	0.60%	0.00%	TA: 0.26%
Aus	269	75.80%	21.20%	0.74%	0.00%	TA: 2.23%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	93.90%	5.70%	0.25%	0.00%	TA: 0.13%
Temperate Japonica	767	48.10%	50.70%	0.91%	0.00%	TA: 0.26%
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	92.50%	0.83%	0.00%	TA: 0.83%
VI/Aromatic	96	18.80%	80.20%	0.00%	0.00%	TA: 1.04%
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0625656832	T -> A	LOC_Os06g42660.1	downstream_gene_variant ; 602.0bp to feature; MODIFIER	silent_mutation	Average:71.084; most accessible tissue: Zhenshan97 flower, score: 89.027	N	N	N	N
vg0625656832	T -> A	LOC_Os06g42660-LOC_Os06g42670	intergenic_region ; MODIFIER	silent_mutation	Average:71.084; most accessible tissue: Zhenshan97 flower, score: 89.027	N	N	N	N
vg0625656832	T -> TA	LOC_Os06g42660.1	downstream_gene_variant ; 603.0bp to feature; MODIFIER	silent_mutation	Average:71.084; most accessible tissue: Zhenshan97 flower, score: 89.027	N	N	N	N
vg0625656832	T -> TA	LOC_Os06g42660-LOC_Os06g42670	intergenic_region ; MODIFIER	silent_mutation	Average:71.084; most accessible tissue: Zhenshan97 flower, score: 89.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0625656832	NA	4.89E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	1.21E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	2.08E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	1.30E-06	1.30E-06	mr1465	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	1.44E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	8.89E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	3.50E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	9.21E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625656832	NA	3.69E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251