\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625654852:

Variant ID: vg0625654852 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25654852
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGGATTAGTATCTATGAGTATCAGGCTGGTAACTACATATTCGAACATAGTATAATACCGTTTTGCGAAAAAAAGGGCACTCCCTCCATTGTAAAAT[A/G]
TAGCATCTTAGGATTAAATTAGATATTTTCTCATGTCCAAATTCTTAATACTAGAAAATTTCCAATCTTATCTTAGTTTGCTATATATTTTTGGAACGAA

Reverse complement sequence

TTCGTTCCAAAAATATATAGCAAACTAAGATAAGATTGGAAATTTTCTAGTATTAAGAATTTGGACATGAGAAAATATCTAATTTAATCCTAAGATGCTA[T/C]
ATTTTACAATGGAGGGAGTGCCCTTTTTTTCGCAAAACGGTATTATACTATGTTCGAATATGTAGTTACCAGCCTGATACTCATAGATACTAATCCTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 6.30% 0.91% 0.00% NA
All Indica  2759 99.60% 0.30% 0.07% 0.00% NA
All Japonica  1512 78.70% 18.60% 2.71% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 95.60% 2.30% 2.09% 0.00% NA
Tropical Japonica  504 50.00% 46.60% 3.37% 0.00% NA
Japonica Intermediate  241 85.10% 11.60% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625654852 A -> G LOC_Os06g42660.1 upstream_gene_variant ; 672.0bp to feature; MODIFIER silent_mutation Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg0625654852 A -> G LOC_Os06g42650-LOC_Os06g42660 intergenic_region ; MODIFIER silent_mutation Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625654852 NA 1.44E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 2.17E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 5.38E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 4.00E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 5.90E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 1.22E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 1.41E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 3.00E-06 3.00E-06 mr1603_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 4.68E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852 NA 3.87E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251