Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625654852:

Variant ID: vg0625654852 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 25654852
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAGGATTAGTATCTATGAGTATCAGGCTGGTAACTACATATTCGAACATAGTATAATACCGTTTTGCGAAAAAAAGGGCACTCCCTCCATTGTAAAAT[A/G]
TAGCATCTTAGGATTAAATTAGATATTTTCTCATGTCCAAATTCTTAATACTAGAAAATTTCCAATCTTATCTTAGTTTGCTATATATTTTTGGAACGAA

Reverse complement sequence

TTCGTTCCAAAAATATATAGCAAACTAAGATAAGATTGGAAATTTTCTAGTATTAAGAATTTGGACATGAGAAAATATCTAATTTAATCCTAAGATGCTA[T/C]
ATTTTACAATGGAGGGAGTGCCCTTTTTTTCGCAAAACGGTATTATACTATGTTCGAATATGTAGTTACCAGCCTGATACTCATAGATACTAATCCTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	6.30%	0.91%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.07%	0.00%	NA
All Japonica	1512	78.70%	18.60%	2.71%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.60%	0.13%	0.00%	NA
Temperate Japonica	767	95.60%	2.30%	2.09%	0.00%	NA
Tropical Japonica	504	50.00%	46.60%	3.37%	0.00%	NA
Japonica Intermediate	241	85.10%	11.60%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0625654852	A -> G	LOC_Os06g42660.1	upstream_gene_variant ; 672.0bp to feature; MODIFIER	silent_mutation	Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0625654852	A -> G	LOC_Os06g42650-LOC_Os06g42660	intergenic_region ; MODIFIER	silent_mutation	Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0625654852	NA	1.44E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	2.17E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	5.38E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	4.00E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	5.90E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	1.22E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	1.41E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	3.00E-06	3.00E-06	mr1603_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	4.68E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625654852	NA	3.87E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251