\
| Variant ID: vg0625654852 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25654852 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )
ACCAGGATTAGTATCTATGAGTATCAGGCTGGTAACTACATATTCGAACATAGTATAATACCGTTTTGCGAAAAAAAGGGCACTCCCTCCATTGTAAAAT[A/G]
TAGCATCTTAGGATTAAATTAGATATTTTCTCATGTCCAAATTCTTAATACTAGAAAATTTCCAATCTTATCTTAGTTTGCTATATATTTTTGGAACGAA
TTCGTTCCAAAAATATATAGCAAACTAAGATAAGATTGGAAATTTTCTAGTATTAAGAATTTGGACATGAGAAAATATCTAATTTAATCCTAAGATGCTA[T/C]
ATTTTACAATGGAGGGAGTGCCCTTTTTTTCGCAAAACGGTATTATACTATGTTCGAATATGTAGTTACCAGCCTGATACTCATAGATACTAATCCTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.30% | 0.91% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 78.70% | 18.60% | 2.71% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 2.30% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 50.00% | 46.60% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 11.60% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625654852 | A -> G | LOC_Os06g42660.1 | upstream_gene_variant ; 672.0bp to feature; MODIFIER | silent_mutation | Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0625654852 | A -> G | LOC_Os06g42650-LOC_Os06g42660 | intergenic_region ; MODIFIER | silent_mutation | Average:56.619; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625654852 | NA | 1.44E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 2.17E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 5.38E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 4.00E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 5.90E-07 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 1.22E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 1.41E-06 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | 3.00E-06 | 3.00E-06 | mr1603_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 4.68E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625654852 | NA | 3.87E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |