Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0625443240:

Variant ID: vg0625443240 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25443240
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTAGATGATGTGTCATGCTTTAATTGCTAGTGAGTGAAGAAGTAGCATGCTTGCATGTAAATGGGCTACAATAGTAATTGCTAGTTGGTGATGATGTG[G/A]
TATGCTTGCATGTTGAGCTTTAGCTTCTAATAATTGTTGGTGGGTACCAACTATATAAAAAGTATAGATTTGTTCTAGTGCAATCATTCAATCTCTTTTC

Reverse complement sequence

GAAAAGAGATTGAATGATTGCACTAGAACAAATCTATACTTTTTATATAGTTGGTACCCACCAACAATTATTAGAAGCTAAAGCTCAACATGCAAGCATA[C/T]
CACATCATCACCAACTAGCAATTACTATTGTAGCCCATTTACATGCAAGCATGCTACTTCTTCACTCACTAGCAATTAAAGCATGACACATCATCTACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 2.70% 2.18% 0.00% NA
All Indica  2759 97.90% 0.10% 1.96% 0.00% NA
All Japonica  1512 88.90% 8.10% 3.04% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 93.10% 0.00% 6.89% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.30% 1.40% 0.00% NA
Temperate Japonica  767 94.50% 1.80% 3.65% 0.00% NA
Tropical Japonica  504 88.70% 9.50% 1.79% 0.00% NA
Japonica Intermediate  241 71.40% 24.90% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625443240 G -> A LOC_Os06g42340.1 downstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:28.211; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0625443240 G -> A LOC_Os06g42340-LOC_Os06g42350 intergenic_region ; MODIFIER silent_mutation Average:28.211; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625443240 NA 2.03E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 4.72E-08 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 3.66E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 5.85E-08 1.20E-11 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 1.01E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 8.51E-07 2.07E-09 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 2.49E-06 5.79E-08 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 1.70E-06 1.97E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 2.17E-10 1.41E-13 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 4.13E-07 2.65E-09 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 1.86E-09 3.11E-12 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 4.36E-08 2.20E-11 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 1.96E-06 1.09E-07 mr1691 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 7.51E-10 5.91E-13 mr1693 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 2.81E-07 4.25E-09 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 4.86E-06 9.82E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 1.22E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 1.31E-07 3.89E-10 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 2.78E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 7.31E-07 1.07E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 3.78E-06 1.10E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 3.45E-06 5.89E-09 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 2.78E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 2.53E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 1.74E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 6.36E-06 2.15E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 1.95E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 1.97E-06 2.57E-09 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625443240 NA 9.25E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251