Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625303878:

Variant ID: vg0625303878 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 25303878
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGGGATCTATATATAACTTATTTTTCAAAAAAAAAGGCAAATTTTGATATAGGACACGCAAAAAATGCGTAATTAGCTGAGGGACACCGAGAAAATGT[G/A]
AAACTGACCGAGGTCACTGCAAAATATGTGAATTTTGCCGTAGGACACCGAACGTATTATTTTATTATTTCCCGGCTGAAAGTGGCGTATATTTTTTCGA

Reverse complement sequence

TCGAAAAAATATACGCCACTTTCAGCCGGGAAATAATAAAATAATACGTTCGGTGTCCTACGGCAAAATTCACATATTTTGCAGTGACCTCGGTCAGTTT[C/T]
ACATTTTCTCGGTGTCCCTCAGCTAATTACGCATTTTTTGCGTGTCCTATATCAAAATTTGCCTTTTTTTTTGAAAAATAAGTTATATATAGATCCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.00%	2.20%	0.78%	0.00%	NA
All Indica	2759	98.80%	1.00%	0.25%	0.00%	NA
All Japonica	1512	93.00%	5.00%	1.98%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.00%	0.67%	0.00%	NA
Indica II	465	98.10%	1.50%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.13%	0.00%	NA
Temperate Japonica	767	98.20%	0.00%	1.83%	0.00%	NA
Tropical Japonica	504	82.30%	14.90%	2.78%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0625303878	G -> A	LOC_Os06g42140.1	downstream_gene_variant ; 248.0bp to feature; MODIFIER	silent_mutation	Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0625303878	G -> A	LOC_Os06g42150.1	downstream_gene_variant ; 1467.0bp to feature; MODIFIER	silent_mutation	Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N
vg0625303878	G -> A	LOC_Os06g42130-LOC_Os06g42140	intergenic_region ; MODIFIER	silent_mutation	Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0625303878	1.02E-06	6.71E-08	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	NA	2.41E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	3.81E-07	2.95E-09	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	2.32E-07	1.56E-07	mr1226	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	7.31E-07	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	3.22E-07	3.22E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	4.36E-06	2.80E-08	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	NA	1.70E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	8.64E-07	1.76E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	1.80E-06	1.98E-06	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	8.29E-06	2.76E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	NA	6.89E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878	NA	5.65E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251