\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625303878:

Variant ID: vg0625303878 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25303878
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGGGATCTATATATAACTTATTTTTCAAAAAAAAAGGCAAATTTTGATATAGGACACGCAAAAAATGCGTAATTAGCTGAGGGACACCGAGAAAATGT[G/A]
AAACTGACCGAGGTCACTGCAAAATATGTGAATTTTGCCGTAGGACACCGAACGTATTATTTTATTATTTCCCGGCTGAAAGTGGCGTATATTTTTTCGA

Reverse complement sequence

TCGAAAAAATATACGCCACTTTCAGCCGGGAAATAATAAAATAATACGTTCGGTGTCCTACGGCAAAATTCACATATTTTGCAGTGACCTCGGTCAGTTT[C/T]
ACATTTTCTCGGTGTCCCTCAGCTAATTACGCATTTTTTGCGTGTCCTATATCAAAATTTGCCTTTTTTTTTGAAAAATAAGTTATATATAGATCCCGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 2.20% 0.78% 0.00% NA
All Indica  2759 98.80% 1.00% 0.25% 0.00% NA
All Japonica  1512 93.00% 5.00% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 98.10% 1.50% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 0.00% 1.83% 0.00% NA
Tropical Japonica  504 82.30% 14.90% 2.78% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625303878 G -> A LOC_Os06g42140.1 downstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0625303878 G -> A LOC_Os06g42150.1 downstream_gene_variant ; 1467.0bp to feature; MODIFIER silent_mutation Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0625303878 G -> A LOC_Os06g42130-LOC_Os06g42140 intergenic_region ; MODIFIER silent_mutation Average:55.1; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625303878 1.02E-06 6.71E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 NA 2.41E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 3.81E-07 2.95E-09 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 2.32E-07 1.56E-07 mr1226 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 7.31E-07 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 3.22E-07 3.22E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 4.36E-06 2.80E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 NA 1.70E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 8.64E-07 1.76E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 1.80E-06 1.98E-06 mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 8.29E-06 2.76E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 NA 6.89E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625303878 NA 5.65E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251