Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0625216580:

Variant ID: vg0625216580 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 25216580
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAGTCTTCACCCATTAAAAGCAGCTGACATGGGCGCCCCTCGTGTCAGGCGGCAAGATTTGACAGGCCCCATCATCAAGATGACGTGCGCTTGCTTCC[C/G]
AAGTCAAGAGATAAGACAGGCATTTAATGCAAAACACTTCTTTACCGGAGCTAGGTTTTTGGGCCCATGTGGTAACCCCTTGAGGTATGAAAGGAGATCC

Reverse complement sequence

GGATCTCCTTTCATACCTCAAGGGGTTACCACATGGGCCCAAAAACCTAGCTCCGGTAAAGAAGTGTTTTGCATTAAATGCCTGTCTTATCTCTTGACTT[G/C]
GGAAGCAAGCGCACGTCATCTTGATGATGGGGCCTGTCAAATCTTGCCGCCTGACACGAGGGGCGCCCATGTCAGCTGCTTTTAATGGGTGAAGACTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	11.20%	0.00%	0.00%	NA
All Indica	2759	98.00%	2.00%	0.00%	0.00%	NA
All Japonica	1512	69.40%	30.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.50%	4.50%	0.00%	0.00%	NA
Temperate Japonica	767	87.50%	12.50%	0.00%	0.00%	NA
Tropical Japonica	504	53.60%	46.40%	0.00%	0.00%	NA
Japonica Intermediate	241	44.80%	55.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0625216580	C -> G	LOC_Os06g42000.1	downstream_gene_variant ; 1255.0bp to feature; MODIFIER	silent_mutation	Average:75.674; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0625216580	C -> G	LOC_Os06g42000-LOC_Os06g42010	intergenic_region ; MODIFIER	silent_mutation	Average:75.674; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0625216580	C	G	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0625216580	3.72E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	2.57E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	3.72E-07	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	7.53E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	NA	5.58E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	7.38E-09	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	6.11E-06	NA	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	NA	1.53E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	7.12E-09	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	9.58E-07	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	6.36E-06	9.33E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	3.94E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	NA	9.42E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	7.70E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625216580	NA	2.69E-07	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251