\
| Variant ID: vg0625197129 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25197129 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAATTGAATGATGTAATCGGATGGATAAATAATTTAAGAGAAACAATAGTTTAAAGTAGTTTTTGCATGCTGATGTCAGCATGACGTGGACGCTCAATGT[G/A]
TAGTTGCCTCCGTATTTGTTACAATTAAATCTTTACAACAAGATCTCACTCGATTATATTCTGATTATTTTTTAAAACTTATTTTGTATTGTTGCGCATA
TATGCGCAACAATACAAAATAAGTTTTAAAAAATAATCAGAATATAATCGAGTGAGATCTTGTTGTAAAGATTTAATTGTAACAAATACGGAGGCAACTA[C/T]
ACATTGAGCGTCCACGTCATGCTGACATCAGCATGCAAAAACTACTTTAAACTATTGTTTCTCTTAAATTATTTATCCATCCGATTACATCATTCAATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.00% | 31.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.40% | 46.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625197129 | G -> A | LOC_Os06g41980.1 | upstream_gene_variant ; 1113.0bp to feature; MODIFIER | silent_mutation | Average:26.439; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0625197129 | G -> A | LOC_Os06g41990.1 | downstream_gene_variant ; 3147.0bp to feature; MODIFIER | silent_mutation | Average:26.439; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0625197129 | G -> A | LOC_Os06g41990.2 | downstream_gene_variant ; 3147.0bp to feature; MODIFIER | silent_mutation | Average:26.439; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0625197129 | G -> A | LOC_Os06g41970-LOC_Os06g41980 | intergenic_region ; MODIFIER | silent_mutation | Average:26.439; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625197129 | 1.52E-06 | NA | mr1086 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 6.33E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 9.11E-08 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 6.66E-06 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 5.66E-08 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | NA | 4.01E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 1.54E-09 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 8.76E-07 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 2.56E-06 | 1.78E-11 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 3.07E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | NA | 5.17E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | 7.86E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625197129 | NA | 9.78E-08 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |