\
| Variant ID: vg0625093787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25093787 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 241. )
GGGAGGCAACCGTGCTAGCCATGAAGGCTGATGGCGTGCCACTTCGCTTCACCAATGGGGTGGACATTGATCAGGTTACCGGAGATGTTTATTTCACCGA[C/T]
AGCAGCATGAACTACCAACGATCTCAGCACGAGCAAGTCACGGCGACCAAGGATTCGACCGGACGGCTCATGAAGTATGACCCACGAACTAACCAAGTCA
TGACTTGGTTAGTTCGTGGGTCATACTTCATGAGCCGTCCGGTCGAATCCTTGGTCGCCGTGACTTGCTCGTGCTGAGATCGTTGGTAGTTCATGCTGCT[G/A]
TCGGTGAAATAAACATCTCCGGTAACCTGATCAATGTCCACCCCATTGGTGAAGCGAAGTGGCACGCCATCAGCCTTCATGGCTAGCACGGTTGCCTCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 42.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 87.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 57.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625093787 | C -> T | LOC_Os06g41850.1 | synonymous_variant ; p.Asp182Asp; LOW | synonymous_codon | Average:74.743; most accessible tissue: Zhenshan97 root, score: 80.68 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625093787 | NA | 6.72E-38 | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 3.11E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 5.03E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 3.89E-42 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | 1.53E-07 | NA | mr1697 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 6.54E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 6.35E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 8.30E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 4.48E-26 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 3.35E-20 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 1.31E-06 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 7.01E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 4.16E-34 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 3.50E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 1.61E-10 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 4.57E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625093787 | NA | 7.48E-45 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |