\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625073430:

Variant ID: vg0625073430 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 25073430
Reference Allele: AAlternative Allele: G,ATATGATTTTTTG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAGCCTAAACAAACAAGCAGCTTATTCGTTTAGCTTTTTAAAAGACATAAGCCACTCTAACACTATTAAGCCAAAAGCTAGGTTGGAGAAGCTTTTTT[A/G,ATATGATTTTTTG]
GCTTATATGAGGTAGATGTATGACTCCACCACTAAACTTATAAGCTGACTTAAAAGTCTAAACCAATAAGCCTAAGCCTAAACAAAGAGGGCCTAAGCCG

Reverse complement sequence

CGGCTTAGGCCCTCTTTGTTTAGGCTTAGGCTTATTGGTTTAGACTTTTAAGTCAGCTTATAAGTTTAGTGGTGGAGTCATACATCTACCTCATATAAGC[T/C,CAAAAAATCATAT]
AAAAAAGCTTCTCCAACCTAGCTTTTGGCTTAATAGTGTTAGAGTGGCTTATGTCTTTTAAAAAGCTAAACGAATAAGCTGCTTGTTTGTTTAGGCTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.50% 0.02% 0.00% ATATGATTTTTTG: 0.02%
All Indica  2759 96.60% 3.30% 0.00% 0.00% ATATGATTTTTTG: 0.04%
All Japonica  1512 4.60% 95.40% 0.00% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.10% 0.00% 0.00% ATATGATTTTTTG: 0.13%
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625073430 A -> G LOC_Os06g41800.1 upstream_gene_variant ; 2402.0bp to feature; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625073430 A -> G LOC_Os06g41810.1 downstream_gene_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625073430 A -> G LOC_Os06g41800-LOC_Os06g41810 intergenic_region ; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625073430 A -> ATATGATTTTTTG LOC_Os06g41800.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625073430 A -> ATATGATTTTTTG LOC_Os06g41810.1 downstream_gene_variant ; 111.0bp to feature; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0625073430 A -> ATATGATTTTTTG LOC_Os06g41800-LOC_Os06g41810 intergenic_region ; MODIFIER silent_mutation Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625073430 1.48E-06 1.10E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 2.02E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 1.54E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 5.24E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 4.71E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 5.77E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 1.73E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 2.43E-06 1.72E-07 mr1369 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 1.57E-06 5.25E-07 mr1453 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 6.94E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 4.89E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 5.65E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 1.53E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 3.26E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 8.14E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625073430 NA 1.55E-56 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251