\
| Variant ID: vg0625073430 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 25073430 |
| Reference Allele: A | Alternative Allele: G,ATATGATTTTTTG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 232. )
TTAAGCCTAAACAAACAAGCAGCTTATTCGTTTAGCTTTTTAAAAGACATAAGCCACTCTAACACTATTAAGCCAAAAGCTAGGTTGGAGAAGCTTTTTT[A/G,ATATGATTTTTTG]
GCTTATATGAGGTAGATGTATGACTCCACCACTAAACTTATAAGCTGACTTAAAAGTCTAAACCAATAAGCCTAAGCCTAAACAAAGAGGGCCTAAGCCG
CGGCTTAGGCCCTCTTTGTTTAGGCTTAGGCTTATTGGTTTAGACTTTTAAGTCAGCTTATAAGTTTAGTGGTGGAGTCATACATCTACCTCATATAAGC[T/C,CAAAAAATCATAT]
AAAAAAGCTTCTCCAACCTAGCTTTTGGCTTAATAGTGTTAGAGTGGCTTATGTCTTTTAAAAAGCTAAACGAATAAGCTGCTTGTTTGTTTAGGCTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.50% | 0.02% | 0.00% | ATATGATTTTTTG: 0.02% |
| All Indica | 2759 | 96.60% | 3.30% | 0.00% | 0.00% | ATATGATTTTTTG: 0.04% |
| All Japonica | 1512 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 7.10% | 0.00% | 0.00% | ATATGATTTTTTG: 0.13% |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625073430 | A -> G | LOC_Os06g41800.1 | upstream_gene_variant ; 2402.0bp to feature; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0625073430 | A -> G | LOC_Os06g41810.1 | downstream_gene_variant ; 112.0bp to feature; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0625073430 | A -> G | LOC_Os06g41800-LOC_Os06g41810 | intergenic_region ; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0625073430 | A -> ATATGATTTTTTG | LOC_Os06g41800.1 | upstream_gene_variant ; 2403.0bp to feature; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0625073430 | A -> ATATGATTTTTTG | LOC_Os06g41810.1 | downstream_gene_variant ; 111.0bp to feature; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0625073430 | A -> ATATGATTTTTTG | LOC_Os06g41800-LOC_Os06g41810 | intergenic_region ; MODIFIER | silent_mutation | Average:72.014; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625073430 | 1.48E-06 | 1.10E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 2.02E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 1.54E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 5.24E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 4.71E-22 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 5.77E-30 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 1.73E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | 2.43E-06 | 1.72E-07 | mr1369 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | 1.57E-06 | 5.25E-07 | mr1453 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 6.94E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 4.89E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 5.65E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 1.53E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 3.26E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 8.14E-37 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625073430 | NA | 1.55E-56 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |