\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625011849:

Variant ID: vg0625011849 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25011849
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.25, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCCAGCTCCACCCCTCCTGGAGCTGGAGCTCAGCCAAACAGTTTCATCTCCACTAAAACTGGGAGTGGAGCTGTCTCACAAAATGAACTAGAGTTGTG[A/G,T]
AGTTGGGTTTAGGCAGCTCCACAACTCTACTCCAGACCCAACTCCTGAAGTTAAATTTAGGAGTTGGAGCTGTACCAAACAGGCCCTTAATTTGAGTCGT

Reverse complement sequence

ACGACTCAAATTAAGGGCCTGTTTGGTACAGCTCCAACTCCTAAATTTAACTTCAGGAGTTGGGTCTGGAGTAGAGTTGTGGAGCTGCCTAAACCCAACT[T/C,A]
CACAACTCTAGTTCATTTTGTGAGACAGCTCCACTCCCAGTTTTAGTGGAGATGAAACTGTTTGGCTGAGCTCCAGCTCCAGGAGGGGTGGAGCTGGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 36.00% 0.21% 3.11% T: 0.02%
All Indica  2759 95.00% 4.00% 0.07% 0.91% T: 0.04%
All Japonica  1512 5.00% 94.80% 0.07% 0.07% NA
Aus  269 44.60% 11.90% 1.12% 42.38% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 97.50% 1.50% 0.22% 0.77% NA
Indica Intermediate  786 88.70% 8.90% 0.00% 2.29% T: 0.13%
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 11.90% 88.10% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 11.50% 81.20% 2.08% 5.21% NA
Intermediate  90 45.60% 50.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625011849 A -> G LOC_Os06g41720.1 upstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> G LOC_Os06g41730.1 upstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> G LOC_Os06g41730.2 upstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> G LOC_Os06g41720-LOC_Os06g41730 intergenic_region ; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> T LOC_Os06g41720.1 upstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> T LOC_Os06g41730.1 upstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> T LOC_Os06g41730.2 upstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> T LOC_Os06g41720-LOC_Os06g41730 intergenic_region ; MODIFIER silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0625011849 A -> DEL N N silent_mutation Average:70.322; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625011849 NA 2.73E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 3.36E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.25E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.62E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 5.26E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 4.19E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 2.45E-06 1.69E-17 mr1276 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.90E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.33E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.66E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 4.56E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 8.89E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 5.53E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 7.78E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 3.48E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 7.60E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 5.85E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.98E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.98E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.32E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.49E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.79E-38 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.80E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.79E-38 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.15E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.57E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.30E-55 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 1.18E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 7.36E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625011849 NA 2.42E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251