\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625009550:

Variant ID: vg0625009550 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25009550
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCTATCATACACACCGCGTCTTATAGTCCGTGCTGTAGTTGGCTACATATTTGTAGCCCGCTGCTCTTCTCTCTTATCTTTTATCTCACTAAAATAT[G/A]
TTTATAGCTGGCTAATAGTCTACTATTATACCTGCTCTAAGCGAAGTTACACGTAAGCACATTTCAGTTGGTCCTCTGCATGCATTCACAAATAGGAGTA

Reverse complement sequence

TACTCCTATTTGTGAATGCATGCAGAGGACCAACTGAAATGTGCTTACGTGTAACTTCGCTTAGAGCAGGTATAATAGTAGACTATTAGCCAGCTATAAA[C/T]
ATATTTTAGTGAGATAAAAGATAAGAGAGAAGAGCAGCGGGCTACAAATATGTAGCCAACTACAGCACGGACTATAAGACGCGGTGTGTATGATAGATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 15.70% 0.11% 0.00% NA
All Indica  2759 96.40% 3.60% 0.00% 0.00% NA
All Japonica  1512 65.80% 33.90% 0.33% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 8.00% 0.00% 0.00% NA
Temperate Japonica  767 88.70% 10.70% 0.65% 0.00% NA
Tropical Japonica  504 35.10% 64.90% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.70% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625009550 G -> A LOC_Os06g41720.1 upstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0625009550 G -> A LOC_Os06g41730.1 upstream_gene_variant ; 4041.0bp to feature; MODIFIER silent_mutation Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0625009550 G -> A LOC_Os06g41730.2 upstream_gene_variant ; 4041.0bp to feature; MODIFIER silent_mutation Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0625009550 G -> A LOC_Os06g41720-LOC_Os06g41730 intergenic_region ; MODIFIER silent_mutation Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625009550 5.84E-07 NA mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 4.70E-07 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 3.41E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 7.79E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 5.86E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 4.84E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550 NA 7.55E-08 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251