\
| Variant ID: vg0625009550 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25009550 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 104. )
CCATCTATCATACACACCGCGTCTTATAGTCCGTGCTGTAGTTGGCTACATATTTGTAGCCCGCTGCTCTTCTCTCTTATCTTTTATCTCACTAAAATAT[G/A]
TTTATAGCTGGCTAATAGTCTACTATTATACCTGCTCTAAGCGAAGTTACACGTAAGCACATTTCAGTTGGTCCTCTGCATGCATTCACAAATAGGAGTA
TACTCCTATTTGTGAATGCATGCAGAGGACCAACTGAAATGTGCTTACGTGTAACTTCGCTTAGAGCAGGTATAATAGTAGACTATTAGCCAGCTATAAA[C/T]
ATATTTTAGTGAGATAAAAGATAAGAGAGAAGAGCAGCGGGCTACAAATATGTAGCCAACTACAGCACGGACTATAAGACGCGGTGTGTATGATAGATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.20% | 15.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 65.80% | 33.90% | 0.33% | 0.00% | NA |
| Aus | 269 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.70% | 10.70% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 35.10% | 64.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625009550 | G -> A | LOC_Os06g41720.1 | upstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0625009550 | G -> A | LOC_Os06g41730.1 | upstream_gene_variant ; 4041.0bp to feature; MODIFIER | silent_mutation | Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0625009550 | G -> A | LOC_Os06g41730.2 | upstream_gene_variant ; 4041.0bp to feature; MODIFIER | silent_mutation | Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0625009550 | G -> A | LOC_Os06g41720-LOC_Os06g41730 | intergenic_region ; MODIFIER | silent_mutation | Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625009550 | 5.84E-07 | NA | mr1027_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 4.70E-07 | mr1027_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 3.41E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 7.79E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 5.86E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 4.84E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625009550 | NA | 7.55E-08 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |