Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625009550:

Variant ID: vg0625009550 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 25009550
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCATCTATCATACACACCGCGTCTTATAGTCCGTGCTGTAGTTGGCTACATATTTGTAGCCCGCTGCTCTTCTCTCTTATCTTTTATCTCACTAAAATAT[G/A]
TTTATAGCTGGCTAATAGTCTACTATTATACCTGCTCTAAGCGAAGTTACACGTAAGCACATTTCAGTTGGTCCTCTGCATGCATTCACAAATAGGAGTA

Reverse complement sequence

TACTCCTATTTGTGAATGCATGCAGAGGACCAACTGAAATGTGCTTACGTGTAACTTCGCTTAGAGCAGGTATAATAGTAGACTATTAGCCAGCTATAAA[C/T]
ATATTTTAGTGAGATAAAAGATAAGAGAGAAGAGCAGCGGGCTACAAATATGTAGCCAACTACAGCACGGACTATAAGACGCGGTGTGTATGATAGATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	15.70%	0.11%	0.00%	NA
All Indica	2759	96.40%	3.60%	0.00%	0.00%	NA
All Japonica	1512	65.80%	33.90%	0.33%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	92.00%	8.00%	0.00%	0.00%	NA
Temperate Japonica	767	88.70%	10.70%	0.65%	0.00%	NA
Tropical Japonica	504	35.10%	64.90%	0.00%	0.00%	NA
Japonica Intermediate	241	57.30%	42.70%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0625009550	G -> A	LOC_Os06g41720.1	upstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0625009550	G -> A	LOC_Os06g41730.1	upstream_gene_variant ; 4041.0bp to feature; MODIFIER	silent_mutation	Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0625009550	G -> A	LOC_Os06g41730.2	upstream_gene_variant ; 4041.0bp to feature; MODIFIER	silent_mutation	Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0625009550	G -> A	LOC_Os06g41720-LOC_Os06g41730	intergenic_region ; MODIFIER	silent_mutation	Average:67.137; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0625009550	5.84E-07	NA	mr1027_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	4.70E-07	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	3.41E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	7.79E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	5.86E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	4.84E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625009550	NA	7.55E-08	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251