Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624913214:

Variant ID: vg0624913214 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24913214
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, G: 0.47, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGCAACATCCATGAGCATGTGCACCACCTCGCGTATTGTTGGCCTCATAGATGGGTCCACCTGTATGCACCATATACGCCACACGTGCGTACCTCTC[G/C]
GCGCTATCAGCCATGCTCGAGCCTAACACCATGGGTGCCCCGGCCCTCTCTCTTCTTCCCCCACGAGTTGAGACTTCAGACATTCTCCCGTCCTCGATAA

Reverse complement sequence

TTATCGAGGACGGGAGAATGTCTGAAGTCTCAACTCGTGGGGGAAGAAGAGAGAGGGCCGGGGCACCCATGGTGTTAGGCTCGAGCATGGCTGATAGCGC[C/G]
GAGAGGTACGCACGTGTGGCGTATATGGTGCATACAGGTGGACCCATCTATGAGGCCAACAATACGCGAGGTGGTGCACATGCTCATGGATGTTGCCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	19.40%	0.32%	44.01%	NA
All Indica	2759	4.90%	24.60%	0.47%	70.03%	NA
All Japonica	1512	94.20%	0.10%	0.07%	5.56%	NA
Aus	269	9.30%	77.70%	0.37%	12.64%	NA
Indica I	595	0.70%	66.60%	0.17%	32.61%	NA
Indica II	465	6.90%	4.10%	0.22%	88.82%	NA
Indica III	913	2.70%	11.60%	0.55%	85.10%	NA
Indica Intermediate	786	9.50%	20.00%	0.76%	69.72%	NA
Temperate Japonica	767	97.50%	0.10%	0.13%	2.22%	NA
Tropical Japonica	504	86.70%	0.00%	0.00%	13.29%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	16.70%	0.00%	1.04%	NA
Intermediate	90	53.30%	14.40%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624913214	G -> C	LOC_Os06g41570.1	synonymous_variant ; p.Ala122Ala; LOW	synonymous_codon	Average:47.33; most accessible tissue: Callus, score: 95.269	N	N	N	N
vg0624913214	G -> DEL	LOC_Os06g41570.1	N	frameshift_variant	Average:47.33; most accessible tissue: Callus, score: 95.269	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0624913214	G	C	0.02	0.0	-0.01	0.01	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624913214	NA	4.52E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	1.03E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	1.60E-11	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	4.45E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	8.01E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	2.64E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	1.11E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	3.67E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	2.01E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624913214	NA	2.39E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251