\
| Variant ID: vg0624862159 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24862159 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )
TCGCAGCACCTTAAGCCTTGCGGTGATCCTAGAGTCGCCAACCACCTCGATCTAGCAAAGAGCTAAACCTAGATGGGTTTTGATAACTAAACCGGCTAGC[A/G]
GAGCCGATTTCTAGATAACTACCCGTCTCGTGGGCAAAACAGAAAGTTTTCAGGACAAACCTACAAAGAGGTGTCGCACTCTCGCAGCGGCGGCGGACGG
CCGTCCGCCGCCGCTGCGAGAGTGCGACACCTCTTTGTAGGTTTGTCCTGAAAACTTTCTGTTTTGCCCACGAGACGGGTAGTTATCTAGAAATCGGCTC[T/C]
GCTAGCCGGTTTAGTTATCAAAACCCATCTAGGTTTAGCTCTTTGCTAGATCGAGGTGGTTGGCGACTCTAGGATCACCGCAAGGCTTAAGGTGCTGCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 9.60% | 0.21% | 1.31% | NA |
| All Indica | 2759 | 98.90% | 0.90% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 67.80% | 27.80% | 0.33% | 4.03% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 54.90% | 44.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 6.00% | 0.00% | 12.10% | NA |
| Japonica Intermediate | 241 | 79.30% | 19.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624862159 | A -> G | LOC_Os06g41480.1 | upstream_gene_variant ; 4738.0bp to feature; MODIFIER | silent_mutation | Average:53.257; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0624862159 | A -> G | LOC_Os06g41470.1 | downstream_gene_variant ; 2395.0bp to feature; MODIFIER | silent_mutation | Average:53.257; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0624862159 | A -> G | LOC_Os06g41470-LOC_Os06g41480 | intergenic_region ; MODIFIER | silent_mutation | Average:53.257; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0624862159 | A -> DEL | N | N | silent_mutation | Average:53.257; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624862159 | NA | 5.90E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | NA | 5.10E-08 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 5.94E-07 | NA | mr1070_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 9.73E-07 | NA | mr1076_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 8.35E-06 | NA | mr1103_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 4.38E-06 | NA | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 5.58E-06 | NA | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 1.83E-06 | 1.55E-06 | mr1227_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | NA | 1.35E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 8.42E-06 | NA | mr1241_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 6.11E-06 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 7.13E-06 | 1.44E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 1.46E-06 | NA | mr1437_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | NA | 1.18E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624862159 | 1.66E-06 | NA | mr1949_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |