\
| Variant ID: vg0624773677 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24773677 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATATATATATATATATTTACAATCAAGCTACGAGGAAAAAAATAAAACATCATAGTATAGTTTATCAGTACTTATCATATGAAATAAACAAATGATAC[C/T]
GCACTTTAATATGAAACAAATTTTTTAGGGGTAATGTTAAATATTACAAAAATAATATATGGATTTGTTACAATATTATGAAAATAATATGAGGGGTGAT
ATCACCCCTCATATTATTTTCATAATATTGTAACAAATCCATATATTATTTTTGTAATATTTAACATTACCCCTAAAAAATTTGTTTCATATTAAAGTGC[G/A]
GTATCATTTGTTTATTTCATATGATAAGTACTGATAAACTATACTATGATGTTTTATTTTTTTCCTCGTAGCTTGATTGTAAATATATATATATATATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 3.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.20% | 9.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 27.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624773677 | C -> T | LOC_Os06g41350.1 | downstream_gene_variant ; 4070.0bp to feature; MODIFIER | silent_mutation | Average:29.321; most accessible tissue: Callus, score: 58.494 | N | N | N | N |
| vg0624773677 | C -> T | LOC_Os06g41350-LOC_Os06g41360 | intergenic_region ; MODIFIER | silent_mutation | Average:29.321; most accessible tissue: Callus, score: 58.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624773677 | NA | 3.24E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624773677 | NA | 2.89E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624773677 | 9.47E-07 | 9.47E-07 | mr1848 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624773677 | 1.31E-06 | 8.91E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |