\
| Variant ID: vg0624749710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24749710 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 109. )
CATTAAATCAATAATAATTGAATATATTTTCATAATAAATTTATCTTGGGTTGAAAATATATTTTTTTATAAACTTAGTCAAACTTGACCAAAGTCAAAG[C/T]
GTCTTATAAGCTGAAACGGAGGTAGTACACATTATGCTACGGGACACCAACTACGTAGTTCCCAAACCTTGTGCAGAAATAGTACCCAAAACACAACTCA
TGAGTTGTGTTTTGGGTACTATTTCTGCACAAGGTTTGGGAACTACGTAGTTGGTGTCCCGTAGCATAATGTGTACTACCTCCGTTTCAGCTTATAAGAC[G/A]
CTTTGACTTTGGTCAAGTTTGACTAAGTTTATAAAAAAATATATTTTCAACCCAAGATAAATTTATTATGAAAATATATTCAATTATTATTGATTTAATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 41.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 10.60% | 89.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 6.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 89.00% | 10.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 13.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.00% | 72.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624749710 | C -> T | LOC_Os06g41340.1 | downstream_gene_variant ; 1288.0bp to feature; MODIFIER | silent_mutation | Average:41.031; most accessible tissue: Callus, score: 83.53 | N | N | N | N |
| vg0624749710 | C -> T | LOC_Os06g41330-LOC_Os06g41340 | intergenic_region ; MODIFIER | silent_mutation | Average:41.031; most accessible tissue: Callus, score: 83.53 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624749710 | NA | 4.17E-25 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 2.51E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 4.95E-22 | mr1583 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 2.12E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | 9.86E-06 | 9.86E-06 | mr1848 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 4.67E-19 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 3.15E-28 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 1.13E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 6.99E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | NA | 5.80E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | 4.09E-09 | 1.39E-17 | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624749710 | 4.16E-06 | 1.28E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |