Search for Variation information by Variation ID:
Detailed information for vg0624690267:
| Variant ID: vg0624690267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24690267 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGTGACAAGTGACGAATTCAAGGATCTTC[G/A]
GGAGTGGAACACTTCTATGCCATAATGTAACTAGATGGCGTATTTGAAGTGACAATATAAAAAAATATAGTAATATATATATATATATATATATATATAT
Reverse complement sequence
ATATATATATATATATATATATATATATTACTATATTTTTTTATATTGTCACTTCAAATACGCCATCTAGTTACATTATGGCATAGAAGTGTTCCACTCC[C/T]
GAAGATCCTTGAATTCGTCACTTGTCACTAGGGCACCCTCTGGGTCAAAGAAATCTCCTTTCACATGACAGCACTCATGGTGGATGAAGTGGCACAGATC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 5.70% | 3.45% | 8.21% | NA |
| All Indica | 2759 | 97.30% | 1.60% | 0.18% | 0.94% | NA |
| All Japonica | 1512 | 71.70% | 0.00% | 9.92% | 18.39% | NA |
| Aus | 269 | 19.70% | 77.00% | 1.49% | 1.86% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 2.60% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 95.40% | 1.70% | 0.38% | 2.54% | NA |
| Temperate Japonica | 767 | 73.10% | 0.00% | 11.99% | 14.86% | NA |
| Tropical Japonica | 504 | 65.10% | 0.00% | 6.94% | 27.98% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.00% | 9.54% | 9.54% | NA |
| VI/Aromatic | 96 | 13.50% | 17.70% | 3.12% | 65.62% | NA |
| Intermediate | 90 | 78.90% | 2.20% | 1.11% | 17.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624690267 | G -> A | LOC_Os06g41250.1 | missense_variant ; p.Arg992Gln; MODERATE | nonsynonymous_codon ; R992Q | Average:23.74; most accessible tissue: Minghui63 panicle, score: 38.588 | benign  |
0.587 |
TOLERATED | 0.07 |
| vg0624690267 | G -> DEL | LOC_Os06g41250.1 | N | frameshift_variant | Average:23.74; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624690267 | NA | 1.89E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | NA | 2.35E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | NA | 1.39E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | NA | 7.17E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | NA | 1.39E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | NA | 1.05E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624690267 | 8.81E-07 | 1.31E-06 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |