\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624655960:

Variant ID: vg0624655960 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24655960
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, A: 0.16, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAACTTTTACACTCCTAGATAGTTACTCTCCTAGACCTTTGGTCTTATGTAACTCCCTAGTATTGATTGTAACTCAGCACTAGCATTGATTGTAATT[C/A]
TGCTATATATATATGAGAGTTCACCTCCCCACATTGGTGAGGCATCTATTCCACTTTCTCTACAGTTAGCAGCAAGCATATTTAACTTGCTATTGTTACA

Reverse complement sequence

TGTAACAATAGCAAGTTAAATATGCTTGCTGCTAACTGTAGAGAAAGTGGAATAGATGCCTCACCAATGTGGGGAGGTGAACTCTCATATATATATAGCA[G/T]
AATTACAATCAATGCTAGTGCTGAGTTACAATCAATACTAGGGAGTTACATAAGACCAAAGGTCTAGGAGAGTAACTATCTAGGAGTGTAAAAGTTTAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 41.80% 2.39% 3.13% NA
All Indica  2759 87.00% 9.20% 2.65% 1.12% NA
All Japonica  1512 1.30% 89.20% 2.25% 7.34% NA
Aus  269 12.60% 86.20% 1.12% 0.00% NA
Indica I  595 95.00% 1.20% 3.87% 0.00% NA
Indica II  465 89.90% 5.80% 2.15% 2.15% NA
Indica III  913 83.20% 15.00% 1.75% 0.00% NA
Indica Intermediate  786 83.60% 10.70% 3.05% 2.67% NA
Temperate Japonica  767 1.80% 97.70% 0.26% 0.26% NA
Tropical Japonica  504 0.80% 72.60% 6.15% 20.44% NA
Japonica Intermediate  241 0.40% 96.70% 0.41% 2.49% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 37.80% 52.20% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624655960 C -> A LOC_Os06g41190.1 downstream_gene_variant ; 3426.0bp to feature; MODIFIER silent_mutation Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0624655960 C -> A LOC_Os06g41200.1 intron_variant ; MODIFIER silent_mutation Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0624655960 C -> DEL N N silent_mutation Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624655960 NA 8.20E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 1.56E-14 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 2.31E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 4.64E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 6.09E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 9.88E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 6.36E-08 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 8.71E-06 NA mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 4.64E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 7.37E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 1.67E-06 1.02E-06 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 7.27E-06 NA mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624655960 NA 8.40E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251