\
| Variant ID: vg0624655960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24655960 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, A: 0.16, others allele: 0.00, population size: 94. )
CCTAAACTTTTACACTCCTAGATAGTTACTCTCCTAGACCTTTGGTCTTATGTAACTCCCTAGTATTGATTGTAACTCAGCACTAGCATTGATTGTAATT[C/A]
TGCTATATATATATGAGAGTTCACCTCCCCACATTGGTGAGGCATCTATTCCACTTTCTCTACAGTTAGCAGCAAGCATATTTAACTTGCTATTGTTACA
TGTAACAATAGCAAGTTAAATATGCTTGCTGCTAACTGTAGAGAAAGTGGAATAGATGCCTCACCAATGTGGGGAGGTGAACTCTCATATATATATAGCA[G/T]
AATTACAATCAATGCTAGTGCTGAGTTACAATCAATACTAGGGAGTTACATAAGACCAAAGGTCTAGGAGAGTAACTATCTAGGAGTGTAAAAGTTTAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 41.80% | 2.39% | 3.13% | NA |
| All Indica | 2759 | 87.00% | 9.20% | 2.65% | 1.12% | NA |
| All Japonica | 1512 | 1.30% | 89.20% | 2.25% | 7.34% | NA |
| Aus | 269 | 12.60% | 86.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 95.00% | 1.20% | 3.87% | 0.00% | NA |
| Indica II | 465 | 89.90% | 5.80% | 2.15% | 2.15% | NA |
| Indica III | 913 | 83.20% | 15.00% | 1.75% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 10.70% | 3.05% | 2.67% | NA |
| Temperate Japonica | 767 | 1.80% | 97.70% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 0.80% | 72.60% | 6.15% | 20.44% | NA |
| Japonica Intermediate | 241 | 0.40% | 96.70% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 52.20% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624655960 | C -> A | LOC_Os06g41190.1 | downstream_gene_variant ; 3426.0bp to feature; MODIFIER | silent_mutation | Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0624655960 | C -> A | LOC_Os06g41200.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0624655960 | C -> DEL | N | N | silent_mutation | Average:25.651; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624655960 | NA | 8.20E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 1.56E-14 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 2.31E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 4.64E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 6.09E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 9.88E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 6.36E-08 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | 8.71E-06 | NA | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | 4.64E-06 | NA | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | 7.37E-06 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | 1.67E-06 | 1.02E-06 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | 7.27E-06 | NA | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624655960 | NA | 8.40E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |