Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624629287:

Variant ID: vg0624629287 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24629287
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAACCATAGAATTGATTTGGTTTAGAATAATTAAAGTAGAATATTGATTGATAATTTAAAAGTAAAAGAAAGGTGGTGTGGCTTCATGTGGGAAGCAA[A/C]
TGAGGGATAAAATTTGGACTATAGATTAATCATCTAAAGGCTAGAAATAATTTAGGTGATATATGGTCTAATGAGAAGATAGAAAACATTAACTAAATGA

Reverse complement sequence

TCATTTAGTTAATGTTTTCTATCTTCTCATTAGACCATATATCACCTAAATTATTTCTAGCCTTTAGATGATTAATCTATAGTCCAAATTTTATCCCTCA[T/G]
TTGCTTCCCACATGAAGCCACACCACCTTTCTTTTACTTTTAAATTATCAATCAATATTCTACTTTAATTATTCTAAACCAAATCAATTCTATGGTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	34.20%	0.04%	0.00%	NA
All Indica	2759	94.60%	5.40%	0.07%	0.00%	NA
All Japonica	1512	11.50%	88.50%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	90.90%	9.00%	0.11%	0.00%	NA
Indica Intermediate	786	93.40%	6.50%	0.13%	0.00%	NA
Temperate Japonica	767	2.30%	97.70%	0.00%	0.00%	NA
Tropical Japonica	504	29.00%	71.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624629287	A -> C	LOC_Os06g41150.1	downstream_gene_variant ; 2551.0bp to feature; MODIFIER	silent_mutation	Average:19.878; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0624629287	A -> C	LOC_Os06g41160.1	downstream_gene_variant ; 636.0bp to feature; MODIFIER	silent_mutation	Average:19.878; most accessible tissue: Callus, score: 57.625	N	N	N	N
vg0624629287	A -> C	LOC_Os06g41160-LOC_Os06g41170	intergenic_region ; MODIFIER	silent_mutation	Average:19.878; most accessible tissue: Callus, score: 57.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624629287	NA	2.21E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	1.26E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	1.69E-21	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	2.09E-33	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	5.58E-43	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	7.35E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	4.39E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	3.95E-33	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	9.70E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	4.95E-06	5.78E-43	mr1601	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	3.16E-53	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	8.90E-42	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	4.13E-40	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	2.20E-26	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	2.66E-60	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	3.77E-27	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	2.89E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	2.10E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	5.33E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	1.16E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629287	NA	1.04E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251