\
| Variant ID: vg0624609971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24609971 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
AAGCTAGGTTTTAGAGCTTTTCCAGATTCTCAGAAGCTGGCTACCAAACAACTGCTTCTCAGAATCTAAAGCTTCCCCAAACAGGCCCAAAGTTTGTCTT[C/T]
ATTAGAGTTCACATGAAAAAGTCATGAATTATTTTTAAATATAAAGTCTTTAGACCGTCCTATTTGACTCAGATGATATTCAAATCCAAGTTTAGAGACC
GGTCTCTAAACTTGGATTTGAATATCATCTGAGTCAAATAGGACGGTCTAAAGACTTTATATTTAAAAATAATTCATGACTTTTTCATGTGAACTCTAAT[G/A]
AAGACAAACTTTGGGCCTGTTTGGGGAAGCTTTAGATTCTGAGAAGCAGTTGTTTGGTAGCCAGCTTCTGAGAATCTGGAAAAGCTCTAAAACCTAGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.90% | 19.00% | 3.07% | 0.00% | NA |
| All Indica | 2759 | 63.30% | 31.80% | 4.89% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 27.20% | 62.40% | 10.42% | 0.00% | NA |
| Indica II | 465 | 40.40% | 54.00% | 5.59% | 0.00% | NA |
| Indica III | 913 | 96.90% | 2.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 65.00% | 30.20% | 4.83% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 16.70% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624609971 | C -> T | LOC_Os06g41140-LOC_Os06g41150 | intergenic_region ; MODIFIER | silent_mutation | Average:29.007; most accessible tissue: Callus, score: 40.84 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624609971 | NA | 1.69E-11 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 1.99E-10 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 1.99E-08 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 9.68E-11 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 4.59E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 4.28E-08 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 6.19E-10 | mr1582_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624609971 | NA | 3.65E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |