\
| Variant ID: vg0624535916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24535916 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATATCATAAAGAGCTCTGCTATAAATACGATAAATATCTTACTATTAGTGTACGGTGCCTTCTAATCTCTAATACATGCAACAAATATAGGGTCCACAAT[G/A]
TTTCCATGGCCAATCAATTATCATGCATGACACTAGATCGTACCAAAATCGTAACAAGTTTATCTTACGTACATCAATTTCCTATCATAAAACCGACCGG
CCGGTCGGTTTTATGATAGGAAATTGATGTACGTAAGATAAACTTGTTACGATTTTGGTACGATCTAGTGTCATGCATGATAATTGATTGGCCATGGAAA[C/T]
ATTGTGGACCCTATATTTGTTGCATGTATTAGAGATTAGAAGGCACCGTACACTAATAGTAAGATATTTATCGTATTTATAGCAGAGCTCTTTATGATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 30.00% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 16.80% | 82.60% | 0.60% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 3.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.30% | 97.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 43.50% | 55.40% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 35.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624535916 | G -> A | LOC_Os06g41070.1 | upstream_gene_variant ; 2118.0bp to feature; MODIFIER | silent_mutation | Average:53.114; most accessible tissue: Zhenshan97 root, score: 84.358 | N | N | N | N |
| vg0624535916 | G -> A | LOC_Os06g41070-LOC_Os06g41090 | intergenic_region ; MODIFIER | silent_mutation | Average:53.114; most accessible tissue: Zhenshan97 root, score: 84.358 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624535916 | NA | 7.46E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 1.17E-17 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 5.41E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 9.83E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 1.33E-07 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 4.92E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 8.11E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 4.79E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 1.09E-24 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | NA | 2.44E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | 7.22E-09 | 5.61E-08 | mr1498_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | 1.52E-06 | 2.70E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624535916 | 2.32E-06 | 5.01E-07 | mr1925_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |