\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624529099:

Variant ID: vg0624529099 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24529099
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTGTCCCATCTAATTCTAGATTGCTATATTATGGGATGGAGGGAGTAGTATTTTTTTTTCTTTTCTTTTTAGGGTGTACAATATCCTACTCCCTTCGT[A/C]
AAAAAAAAACAAACCCTGGTTTCCGTGTCCAACGTTGGCATGAAAACCTAGTTTTTTTTTTTTTTGTTGGACGGAGGTAGTATGTATACTCACTACGTTG

Reverse complement sequence

CAACGTAGTGAGTATACATACTACCTCCGTCCAACAAAAAAAAAAAAAACTAGGTTTTCATGCCAACGTTGGACACGGAAACCAGGGTTTGTTTTTTTTT[T/G]
ACGAAGGGAGTAGGATATTGTACACCCTAAAAAGAAAAGAAAAAAAAATACTACTCCCTCCATCCCATAATATAGCAATCTAGAATTAGATGGGACACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 15.20% 4.66% 6.24% NA
All Indica  2759 89.30% 1.60% 5.04% 4.06% NA
All Japonica  1512 46.10% 37.30% 5.03% 11.57% NA
Aus  269 94.80% 3.30% 0.74% 1.12% NA
Indica I  595 88.60% 0.00% 7.73% 3.70% NA
Indica II  465 88.60% 2.20% 4.30% 4.95% NA
Indica III  913 91.10% 1.80% 3.72% 3.40% NA
Indica Intermediate  786 88.00% 2.40% 4.96% 4.58% NA
Temperate Japonica  767 57.90% 16.20% 7.04% 18.90% NA
Tropical Japonica  504 36.90% 60.50% 1.79% 0.79% NA
Japonica Intermediate  241 27.80% 56.00% 5.39% 10.79% NA
VI/Aromatic  96 19.80% 79.20% 0.00% 1.04% NA
Intermediate  90 64.40% 27.80% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624529099 A -> C LOC_Os06g41060.1 upstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:84.222; most accessible tissue: Zhenshan97 panicle, score: 94.518 N N N N
vg0624529099 A -> C LOC_Os06g41070.1 downstream_gene_variant ; 2727.0bp to feature; MODIFIER silent_mutation Average:84.222; most accessible tissue: Zhenshan97 panicle, score: 94.518 N N N N
vg0624529099 A -> C LOC_Os06g41060-LOC_Os06g41070 intergenic_region ; MODIFIER silent_mutation Average:84.222; most accessible tissue: Zhenshan97 panicle, score: 94.518 N N N N
vg0624529099 A -> DEL N N silent_mutation Average:84.222; most accessible tissue: Zhenshan97 panicle, score: 94.518 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0624529099 A C 0.05 0.02 0.01 0.0 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624529099 NA 2.50E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 6.72E-12 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 7.09E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 8.12E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 1.62E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 8.21E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 6.70E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 1.28E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 5.96E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 2.01E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 2.74E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 NA 7.65E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 9.32E-06 NA mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624529099 4.10E-06 NA mr1896_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251