\
| Variant ID: vg0624426383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24426383 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 286. )
AAGTTAGTGGACTATCTCGATATCAATGAGGTCAGATCCAATGATATACACGCTATGTTGAACACATATGGGGTAGAGGCTGCAAGGGCAACCATCATTG[G/A]
GGAAGTGAAGGGCGTATTCGGTGCTTATGGTATCCATGTTGACATGAGGCATCTGAACTTGATTGCGGATTTCATGACCTTCGACGGCGGTTACCGACCG
CGGTCGGTAACCGCCGTCGAAGGTCATGAAATCCGCAATCAAGTTCAGATGCCTCATGTCAACATGGATACCATAAGCACCGAATACGCCCTTCACTTCC[C/T]
CAATGATGGTTGCCCTTGCAGCCTCTACCCCATATGTGTTCAACATAGCGTGTATATCATTGGATCTGACCTCATTGATATCGAGATAGTCCACTAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 31.50% | 0.08% | 0.11% | NA |
| All Indica | 2759 | 62.20% | 37.50% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.90% | 15.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 48.10% | 51.60% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 54.60% | 45.00% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.20% | 28.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624426383 | G -> A | LOC_Os06g40950.1 | missense_variant ; p.Gly248Glu; MODERATE | nonsynonymous_codon ; G248E | Average:70.479; most accessible tissue: Zhenshan97 panicle, score: 90.849 | benign |
-0.996 |
TOLERATED | 0.99 |
| vg0624426383 | G -> DEL | LOC_Os06g40950.1 | N | frameshift_variant | Average:70.479; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624426383 | NA | 5.78E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0624426383 | NA | 6.81E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 3.37E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 1.95E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | 3.17E-07 | NA | mr1138_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 7.78E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 4.25E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 1.00E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624426383 | NA | 3.22E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |