\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624407686:

Variant ID: vg0624407686 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24407686
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCCCCCCCCCCCCCCCCGCGCCTCCCTCTTCTCCCCTTCCTCCTCCCTTTCTTCTATTTCTACTACAGTACACCACACAAATTTTTTTAAAAAACAA[A/T]
AGTTAGAAAAATTTATGTATAGAAATACTATATATAAAAATTTGAATTCAAATTCAAATTTGAATCTCGGATATGTAAACTTTTGACTTATAAACTTTGG

Reverse complement sequence

CCAAAGTTTATAAGTCAAAAGTTTACATATCCGAGATTCAAATTTGAATTTGAATTCAAATTTTTATATATAGTATTTCTATACATAAATTTTTCTAACT[T/A]
TTGTTTTTTAAAAAAATTTGTGTGGTGTACTGTAGTAGAAATAGAAGAAAGGGAGGAGGAAGGGGAGAAGAGGGAGGCGCGGGGGGGGGGGGGGGGGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 35.10% 1.59% 0.93% NA
All Indica  2759 52.50% 43.70% 2.28% 1.52% NA
All Japonica  1512 88.50% 10.60% 0.73% 0.13% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 81.70% 14.60% 3.19% 0.50% NA
Indica II  465 59.40% 33.80% 2.58% 4.30% NA
Indica III  913 35.40% 62.50% 1.42% 0.66% NA
Indica Intermediate  786 46.20% 49.70% 2.42% 1.65% NA
Temperate Japonica  767 97.80% 0.50% 1.43% 0.26% NA
Tropical Japonica  504 70.80% 29.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624407686 A -> T LOC_Os06g40940.1 upstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:76.226; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N
vg0624407686 A -> T LOC_Os06g40940.3 upstream_gene_variant ; 3060.0bp to feature; MODIFIER silent_mutation Average:76.226; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N
vg0624407686 A -> T LOC_Os06g40940.2 upstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:76.226; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N
vg0624407686 A -> T LOC_Os06g40940-LOC_Os06g40950 intergenic_region ; MODIFIER silent_mutation Average:76.226; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N
vg0624407686 A -> DEL N N silent_mutation Average:76.226; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0624407686 A T -0.01 -0.02 -0.02 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624407686 NA 2.21E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 1.78E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 2.08E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 5.78E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 1.11E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 1.33E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 NA 7.36E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624407686 4.21E-06 1.77E-07 mr1929_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251