\
| Variant ID: vg0624163132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 24163132 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTCACTTCCTTTCCGTCGACCACTTCTTCAAGCTCCTCTTCTCTGACTTGATCCAAATCAGTCAGGGGAAACTCAATCTGATTTTTATCATTATTTATC[G/A]
TACTGATTTTTAATCCCAGATTAATCTCTTGCTATTTTTTGTTGTTGTTCGCATATAATTACGCGGCACTATTGAGGCGATTGATGCTGGTCATGGACTC
GAGTCCATGACCAGCATCAATCGCCTCAATAGTGCCGCGTAATTATATGCGAACAACAACAAAAAATAGCAAGAGATTAATCTGGGATTAAAAATCAGTA[C/T]
GATAAATAATGATAAAAATCAGATTGAGTTTCCCCTGACTGATTTGGATCAAGTCAGAGAAGAGGAGCTTGAAGAAGTGGTCGACGGAAAGGAAGTGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 0.10% | 11.45% | 41.58% | NA |
| All Indica | 2759 | 17.60% | 0.10% | 16.49% | 65.75% | NA |
| All Japonica | 1512 | 92.50% | 0.10% | 5.09% | 2.38% | NA |
| Aus | 269 | 66.90% | 0.00% | 1.49% | 31.60% | NA |
| Indica I | 595 | 7.70% | 0.30% | 8.57% | 83.36% | NA |
| Indica II | 465 | 10.80% | 0.00% | 13.98% | 75.27% | NA |
| Indica III | 913 | 25.00% | 0.10% | 23.33% | 51.59% | NA |
| Indica Intermediate | 786 | 20.60% | 0.10% | 16.03% | 63.23% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 81.20% | 0.00% | 14.09% | 4.76% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 4.44% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624163132 | G -> A | LOC_Os06g40530.1 | upstream_gene_variant ; 3421.0bp to feature; MODIFIER | silent_mutation | Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 | N | N | N | N |
| vg0624163132 | G -> A | LOC_Os06g40540.1 | upstream_gene_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 | N | N | N | N |
| vg0624163132 | G -> A | LOC_Os06g40530-LOC_Os06g40540 | intergenic_region ; MODIFIER | silent_mutation | Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 | N | N | N | N |
| vg0624163132 | G -> DEL | N | N | silent_mutation | Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624163132 | NA | 1.94E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624163132 | NA | 4.26E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624163132 | 2.17E-06 | NA | mr1408 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624163132 | 6.09E-06 | 6.08E-06 | mr1430 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624163132 | NA | 7.50E-07 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624163132 | NA | 1.78E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |