\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624163132:

Variant ID: vg0624163132 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24163132
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCACTTCCTTTCCGTCGACCACTTCTTCAAGCTCCTCTTCTCTGACTTGATCCAAATCAGTCAGGGGAAACTCAATCTGATTTTTATCATTATTTATC[G/A]
TACTGATTTTTAATCCCAGATTAATCTCTTGCTATTTTTTGTTGTTGTTCGCATATAATTACGCGGCACTATTGAGGCGATTGATGCTGGTCATGGACTC

Reverse complement sequence

GAGTCCATGACCAGCATCAATCGCCTCAATAGTGCCGCGTAATTATATGCGAACAACAACAAAAAATAGCAAGAGATTAATCTGGGATTAAAAATCAGTA[C/T]
GATAAATAATGATAAAAATCAGATTGAGTTTCCCCTGACTGATTTGGATCAAGTCAGAGAAGAGGAGCTTGAAGAAGTGGTCGACGGAAAGGAAGTGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 0.10% 11.45% 41.58% NA
All Indica  2759 17.60% 0.10% 16.49% 65.75% NA
All Japonica  1512 92.50% 0.10% 5.09% 2.38% NA
Aus  269 66.90% 0.00% 1.49% 31.60% NA
Indica I  595 7.70% 0.30% 8.57% 83.36% NA
Indica II  465 10.80% 0.00% 13.98% 75.27% NA
Indica III  913 25.00% 0.10% 23.33% 51.59% NA
Indica Intermediate  786 20.60% 0.10% 16.03% 63.23% NA
Temperate Japonica  767 98.30% 0.10% 0.26% 1.30% NA
Tropical Japonica  504 81.20% 0.00% 14.09% 4.76% NA
Japonica Intermediate  241 97.50% 0.00% 1.66% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 63.30% 0.00% 4.44% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624163132 G -> A LOC_Os06g40530.1 upstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg0624163132 G -> A LOC_Os06g40540.1 upstream_gene_variant ; 1983.0bp to feature; MODIFIER silent_mutation Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg0624163132 G -> A LOC_Os06g40530-LOC_Os06g40540 intergenic_region ; MODIFIER silent_mutation Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg0624163132 G -> DEL N N silent_mutation Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624163132 NA 1.94E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132 NA 4.26E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132 2.17E-06 NA mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132 6.09E-06 6.08E-06 mr1430 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132 NA 7.50E-07 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132 NA 1.78E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251