Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624163132:

Variant ID: vg0624163132 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24163132
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCACTTCCTTTCCGTCGACCACTTCTTCAAGCTCCTCTTCTCTGACTTGATCCAAATCAGTCAGGGGAAACTCAATCTGATTTTTATCATTATTTATC[G/A]
TACTGATTTTTAATCCCAGATTAATCTCTTGCTATTTTTTGTTGTTGTTCGCATATAATTACGCGGCACTATTGAGGCGATTGATGCTGGTCATGGACTC

Reverse complement sequence

GAGTCCATGACCAGCATCAATCGCCTCAATAGTGCCGCGTAATTATATGCGAACAACAACAAAAAATAGCAAGAGATTAATCTGGGATTAAAAATCAGTA[C/T]
GATAAATAATGATAAAAATCAGATTGAGTTTCCCCTGACTGATTTGGATCAAGTCAGAGAAGAGGAGCTTGAAGAAGTGGTCGACGGAAAGGAAGTGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	0.10%	11.45%	41.58%	NA
All Indica	2759	17.60%	0.10%	16.49%	65.75%	NA
All Japonica	1512	92.50%	0.10%	5.09%	2.38%	NA
Aus	269	66.90%	0.00%	1.49%	31.60%	NA
Indica I	595	7.70%	0.30%	8.57%	83.36%	NA
Indica II	465	10.80%	0.00%	13.98%	75.27%	NA
Indica III	913	25.00%	0.10%	23.33%	51.59%	NA
Indica Intermediate	786	20.60%	0.10%	16.03%	63.23%	NA
Temperate Japonica	767	98.30%	0.10%	0.26%	1.30%	NA
Tropical Japonica	504	81.20%	0.00%	14.09%	4.76%	NA
Japonica Intermediate	241	97.50%	0.00%	1.66%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	63.30%	0.00%	4.44%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624163132	G -> A	LOC_Os06g40530.1	upstream_gene_variant ; 3421.0bp to feature; MODIFIER	silent_mutation	Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943	N	N	N	N
vg0624163132	G -> A	LOC_Os06g40540.1	upstream_gene_variant ; 1983.0bp to feature; MODIFIER	silent_mutation	Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943	N	N	N	N
vg0624163132	G -> A	LOC_Os06g40530-LOC_Os06g40540	intergenic_region ; MODIFIER	silent_mutation	Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943	N	N	N	N
vg0624163132	G -> DEL	N	N	silent_mutation	Average:13.521; most accessible tissue: Zhenshan97 flag leaf, score: 18.943	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624163132	NA	1.94E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132	NA	4.26E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132	2.17E-06	NA	mr1408	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132	6.09E-06	6.08E-06	mr1430	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132	NA	7.50E-07	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624163132	NA	1.78E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251