\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624030080:

Variant ID: vg0624030080 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24030080
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATTAATCAAACCCCCACAAGAGGCCACCACGAAACCGCGTAGTAGATCAACCTAGGTTATGTTTAGATTCAAATTTGGATTAAACTTCAGTACTTTT[C/T]
CATCACATCAACCTATCATACACACATAATTTTTCTGTCACATCATCTCTAATTTTAACCAAAATCTAAACTTTGCGCTGAACTAAACACAACCCTAGCT

Reverse complement sequence

AGCTAGGGTTGTGTTTAGTTCAGCGCAAAGTTTAGATTTTGGTTAAAATTAGAGATGATGTGACAGAAAAATTATGTGTGTATGATAGGTTGATGTGATG[G/A]
AAAAGTACTGAAGTTTAATCCAAATTTGAATCTAAACATAACCTAGGTTGATCTACTACGCGGTTTCGTGGTGGCCTCTTGTGGGGGTTTGATTAATGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.10% 0.83% 0.00% NA
All Indica  2759 96.60% 3.10% 0.36% 0.00% NA
All Japonica  1512 31.00% 67.60% 1.46% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 95.70% 3.90% 0.43% 0.00% NA
Indica III  913 96.60% 3.10% 0.33% 0.00% NA
Indica Intermediate  786 94.90% 4.60% 0.51% 0.00% NA
Temperate Japonica  767 4.20% 94.90% 0.91% 0.00% NA
Tropical Japonica  504 78.20% 19.60% 2.18% 0.00% NA
Japonica Intermediate  241 17.40% 80.90% 1.66% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 74.40% 17.80% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624030080 C -> T LOC_Os06g40360.1 upstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:94.062; most accessible tissue: Minghui63 root, score: 99.268 N N N N
vg0624030080 C -> T LOC_Os06g40360.2 upstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:94.062; most accessible tissue: Minghui63 root, score: 99.268 N N N N
vg0624030080 C -> T LOC_Os06g40330-LOC_Os06g40360 intergenic_region ; MODIFIER silent_mutation Average:94.062; most accessible tissue: Minghui63 root, score: 99.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0624030080 C T -0.04 -0.04 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624030080 NA 2.78E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 3.98E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.53E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.49E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 7.34E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.06E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 1.33E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 3.56E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 3.51E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 6.88E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 6.77E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 6.11E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 6.18E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 7.59E-29 mr1401_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 3.13E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 2.49E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.04E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.33E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 7.90E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 7.59E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 5.38E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 6.23E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 1.77E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 4.80E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624030080 NA 2.90E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251