RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0624013853:

Variant ID: vg0624013853 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24013853
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTATTAGGAGTCCAATCGTCTCAAGTTAGCATGCGAGTTTTTTTTAAGAGATTTCTATGCGACTCCTTTGGTATTTCTAAAATCGAACGAACTTAAAAA[C/A,T]
CGACTCATATACGGATGACGTACCAAAGTTCTGGCAAAAACATCTTCAGTTTTTATAATAGTAGAGATATAAATGGGAGAAGTTGTTCTGATATCGTGCA

Reverse complement sequence

TGCACGATATCAGAACAACTTCTCCCATTTATATCTCTACTATTATAAAAACTGAAGATGTTTTTGCCAGAACTTTGGTACGTCATCCGTATATGAGTCG[G/T,A]
TTTTTAAGTTCGTTCGATTTTAGAAATACCAAAGGAGTCGCATAGAAATCTCTTAAAAAAAACTCGCATGCTAACTTGAGACGATTGGACTCCTAATAAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	3.90%	2.05%	0.00%	T: 0.02%
All Indica	2759	99.90%	0.00%	0.11%	0.00%	T: 0.04%
All Japonica	1512	81.90%	12.00%	6.08%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.00%	T: 0.13%
Temperate Japonica	767	75.40%	14.90%	9.78%	0.00%	NA
Tropical Japonica	504	93.70%	5.80%	0.60%	0.00%	NA
Japonica Intermediate	241	78.00%	16.20%	5.81%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624013853	C -> T	LOC_Os06g40330.1	upstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:51.032; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0624013853	C -> T	LOC_Os06g40330-LOC_Os06g40360	intergenic_region ; MODIFIER	silent_mutation	Average:51.032; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0624013853	C -> A	LOC_Os06g40330.1	upstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:51.032; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0624013853	C -> A	LOC_Os06g40330-LOC_Os06g40360	intergenic_region ; MODIFIER	silent_mutation	Average:51.032; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624013853	1.32E-06	1.30E-10	mr1691	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624013853	NA	9.45E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0624013853:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact