\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623791757:

Variant ID: vg0623791757 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23791757
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGGTGAAACACAGACTAAACTGTAACGACGCTGAAAGATCGATTCCTGGCGTTTAGTCTTCTGATGGTTTCACCAAAAGCGAGCCATATCCTCCAAAC[G/A]
TCTTGAATGAACATGATCGTAATCTTCTAAGGTTTGCCCGGGGTGCGCCCGCAGCCAGTTGGCAACCTTGAAAACTTTATAGCTGCGACCGTTTATCTCC

Reverse complement sequence

GGAGATAAACGGTCGCAGCTATAAAGTTTTCAAGGTTGCCAACTGGCTGCGGGCGCACCCCGGGCAAACCTTAGAAGATTACGATCATGTTCATTCAAGA[C/T]
GTTTGGAGGATATGGCTCGCTTTTGGTGAAACCATCAGAAGACTAAACGCCAGGAATCGATCTTTCAGCGTCGTTACAGTTTAGTCTGTGTTTCACCCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.30% 0.00% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623791757 G -> A LOC_Os06g40000.1 missense_variant ; p.Arg905Cys; MODERATE N Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0623791757 G -> A LOC_Os06g40010.1 upstream_gene_variant ; 3799.0bp to feature; MODIFIER N Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0623791757 G -> A LOC_Os06g39980.1 downstream_gene_variant ; 3419.0bp to feature; MODIFIER N Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0623791757 G -> A LOC_Os06g39990.1 downstream_gene_variant ; 573.0bp to feature; MODIFIER N Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623791757 1.23E-06 NA mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 3.75E-07 NA mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 NA 4.58E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 NA 7.10E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 NA 2.77E-06 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 9.26E-06 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 8.88E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 6.24E-08 NA mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 3.69E-07 NA mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 4.03E-06 NA mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 2.14E-07 NA mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623791757 1.62E-07 NA mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251