Variant ID: vg0623791757 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 23791757 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )
GGGGGTGAAACACAGACTAAACTGTAACGACGCTGAAAGATCGATTCCTGGCGTTTAGTCTTCTGATGGTTTCACCAAAAGCGAGCCATATCCTCCAAAC[G/A]
TCTTGAATGAACATGATCGTAATCTTCTAAGGTTTGCCCGGGGTGCGCCCGCAGCCAGTTGGCAACCTTGAAAACTTTATAGCTGCGACCGTTTATCTCC
GGAGATAAACGGTCGCAGCTATAAAGTTTTCAAGGTTGCCAACTGGCTGCGGGCGCACCCCGGGCAAACCTTAGAAGATTACGATCATGTTCATTCAAGA[C/T]
GTTTGGAGGATATGGCTCGCTTTTGGTGAAACCATCAGAAGACTAAACGCCAGGAATCGATCTTTCAGCGTCGTTACAGTTTAGTCTGTGTTTCACCCCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0623791757 | G -> A | LOC_Os06g40000.1 | missense_variant ; p.Arg905Cys; MODERATE | N | Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
vg0623791757 | G -> A | LOC_Os06g40010.1 | upstream_gene_variant ; 3799.0bp to feature; MODIFIER | N | Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
vg0623791757 | G -> A | LOC_Os06g39980.1 | downstream_gene_variant ; 3419.0bp to feature; MODIFIER | N | Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
vg0623791757 | G -> A | LOC_Os06g39990.1 | downstream_gene_variant ; 573.0bp to feature; MODIFIER | N | Average:37.294; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0623791757 | 1.23E-06 | NA | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 3.75E-07 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | NA | 4.58E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | NA | 7.10E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | NA | 2.77E-06 | mr1138 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 9.26E-06 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 8.88E-06 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 6.24E-08 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 3.69E-07 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 4.03E-06 | NA | mr1178_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 2.14E-07 | NA | mr1390_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0623791757 | 1.62E-07 | NA | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |