\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623599305:

Variant ID: vg0623599305 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 23599305
Reference Allele: CGAlternative Allele: AG,C
Primary Allele: CGSecondary Allele: AG

Inferred Ancestral Allele : CG (evidence from allele frequency in Oryza rufipogon: CG: 0.99, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTATTTGCTAATCGAGCACTATTTGCAAGTTCAAGGCTAATTTTATTGTGATCTCGATGCACTTTCTGAATTTTAACTTCCCTTTCTCCTCTCTGGAG[CG/AG,C]
AAACGCAGCTCTCGTATCAAGTAAGCAAACCTTGATTTGTCCTCAGTTTCTCCATTAATCACGGATACAGCCAAGATGCTGTCAGACTCAAGGACGATTG

Reverse complement sequence

CAATCGTCCTTGAGTCTGACAGCATCTTGGCTGTATCCGTGATTAATGGAGAAACTGAGGACAAATCAAGGTTTGCTTACTTGATACGAGAGCTGCGTTT[CG/CT,G]
CTCCAGAGAGGAGAAAGGGAAGTTAAAATTCAGAAAGTGCATCGAGATCACAATAAAATTAGCCTTGAACTTGCAAATAGTGCTCGATTAGCAAATAGGT

Allele Frequencies:

Populations Population SizeFrequency of CG(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 26.40% 11.17% 29.31% C: 0.19%
All Indica  2759 34.00% 8.10% 14.68% 42.88% C: 0.29%
All Japonica  1512 20.30% 61.20% 6.94% 11.51% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 9.10% 0.30% 14.29% 76.30% NA
Indica II  465 17.00% 28.20% 22.80% 32.04% NA
Indica III  913 58.50% 1.40% 8.11% 31.22% C: 0.77%
Indica Intermediate  786 34.60% 9.90% 17.81% 37.53% C: 0.13%
Temperate Japonica  767 36.20% 36.60% 9.00% 18.12% NA
Tropical Japonica  504 1.40% 91.30% 3.77% 3.57% NA
Japonica Intermediate  241 9.10% 76.80% 7.05% 7.05% NA
VI/Aromatic  96 21.90% 63.50% 7.29% 6.25% C: 1.04%
Intermediate  90 26.70% 38.90% 12.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623599305 CG -> AG LOC_Os06g39756-LOC_Os06g39750 intergenic_region ; MODIFIER silent_mutation Average:79.109; most accessible tissue: Zhenshan97 flower, score: 88.777 N N N N
vg0623599305 CG -> DEL N N silent_mutation Average:79.109; most accessible tissue: Zhenshan97 flower, score: 88.777 N N N N
vg0623599305 CG -> C LOC_Os06g39756-LOC_Os06g39750 intergenic_region ; MODIFIER silent_mutation Average:79.109; most accessible tissue: Zhenshan97 flower, score: 88.777 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623599305 CG AG 0.0 0.01 0.0 0.0 0.0 -0.01
vg0623599305 CG C -0.02 0.03 0.02 0.18 0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623599305 9.30E-06 NA mr1289 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251