\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623502559:

Variant ID: vg0623502559 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23502559
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, C: 0.14, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TACCTGCGCAAGGTGGACCTCGCGGCGCACGCCGGCTACGCGCCCCTCCTCCGCGCGCTCCACGGCATGTTCGCCTCCTGCCTCGCCGTCCGCGGCGGCG[G/C]
CGGCGGCGACGGCGAGGGTACAAAGCTCGTCGACTTGGTCACCGGCGCCGAGTACGTGCCCACCTACGAGGACAAGGACGGCGACTGGATGCTCGTCGGC

Reverse complement sequence

GCCGACGAGCATCCAGTCGCCGTCCTTGTCCTCGTAGGTGGGCACGTACTCGGCGCCGGTGACCAAGTCGACGAGCTTTGTACCCTCGCCGTCGCCGCCG[C/G]
CGCCGCCGCGGACGGCGAGGCAGGAGGCGAACATGCCGTGGAGCGCGCGGAGGAGGGGCGCGTAGCCGGCGTGCGCCGCGAGGTCCACCTTGCGCAGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.20% 0.04% 0.00% NA
All Indica  2759 90.00% 10.00% 0.04% 0.00% NA
All Japonica  1512 1.50% 98.50% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 85.80% 14.20% 0.00% 0.00% NA
Indica III  913 89.50% 10.50% 0.00% 0.00% NA
Indica Intermediate  786 87.30% 12.60% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623502559 G -> C LOC_Os06g39590.1 missense_variant ; p.Gly128Ala; MODERATE nonsynonymous_codon ; G128A Average:93.399; most accessible tissue: Minghui63 flower, score: 98.045 unknown unknown TOLERATED 0.97
vg0623502559 G -> C LOC_Os06g39590.2 missense_variant ; p.Gly128Ala; MODERATE nonsynonymous_codon ; G128A Average:93.399; most accessible tissue: Minghui63 flower, score: 98.045 unknown unknown TOLERATED 0.73

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623502559 G C 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623502559 3.41E-06 NA mr1004 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 7.85E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 1.93E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 5.25E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 2.34E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 4.55E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623502559 NA 3.34E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251