\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623497575:

Variant ID: vg0623497575 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23497575
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGAGTATACTAATATGTTTGATTGGTTATGCCTAGCTAGCAGCAGGCTAGATATAGATACTAGCTAGTAGTACCTACTGAATAACTACCAAAGGCAT[G/A]
TTTAGTTCGCGAAAAGAAAATTTTTAGATGTTATATCGAACGTTTAACCAGATATTAGAAGGGGTTTTTAGACACGAATGGAAAAATTAATTTCATAACT

Reverse complement sequence

AGTTATGAAATTAATTTTTCCATTCGTGTCTAAAAACCCCTTCTAATATCTGGTTAAACGTTCGATATAACATCTAAAAATTTTCTTTTCGCGAACTAAA[C/T]
ATGCCTTTGGTAGTTATTCAGTAGGTACTACTAGCTAGTATCTATATCTAGCCTGCTGCTAGCTAGGCATAACCAATCAAACATATTAGTATACTCCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 10.30% 0.17% 0.00% NA
All Indica  2759 91.10% 8.90% 0.00% 0.00% NA
All Japonica  1512 96.10% 3.40% 0.53% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 87.70% 12.30% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 93.90% 5.30% 0.78% 0.00% NA
Tropical Japonica  504 98.60% 1.00% 0.40% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623497575 G -> A LOC_Os06g39580.1 upstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:52.0; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0623497575 G -> A LOC_Os06g39590.1 upstream_gene_variant ; 4398.0bp to feature; MODIFIER silent_mutation Average:52.0; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0623497575 G -> A LOC_Os06g39590.2 upstream_gene_variant ; 4398.0bp to feature; MODIFIER silent_mutation Average:52.0; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0623497575 G -> A LOC_Os06g39580-LOC_Os06g39590 intergenic_region ; MODIFIER silent_mutation Average:52.0; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623497575 NA 1.02E-11 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 2.60E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 2.31E-08 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.61E-11 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.68E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 7.97E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 5.18E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 7.39E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.66E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 7.58E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.43E-06 mr1847 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 6.32E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.82E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 2.72E-07 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623497575 NA 1.90E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251