\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623387410:

Variant ID: vg0623387410 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23387410
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTAGACTGAGAAAGTCTCTAATCTCATATGACACTCCATAAACTTTAAACCAAGTTTTCTTTAGAACAAACTTCGCTTCAATCTCTTGCTCCCACTT[G/C]
TCAATGACTAGGTTCACATTAAAGTCAAAACTAGGAACACTGCCAACCCTACGCAACCTGTCTAATTCGATCACAGAGGGAAATTGAACCATATAAGTGT

Reverse complement sequence

ACACTTATATGGTTCAATTTCCCTCTGTGATCGAATTAGACAGGTTGCGTAGGGTTGGCAGTGTTCCTAGTTTTGACTTTAATGTGAACCTAGTCATTGA[C/G]
AAGTGGGAGCAAGAGATTGAAGCGAAGTTTGTTCTAAAGAAAACTTGGTTTAAAGTTTATGGAGTGTCATATGAGATTAGAGACTTTCTCAGTCTACATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 9.20% 2.56% 48.35% NA
All Indica  2759 46.60% 15.50% 3.81% 34.07% NA
All Japonica  1512 21.30% 0.10% 0.46% 78.17% NA
Aus  269 81.40% 0.40% 0.37% 17.84% NA
Indica I  595 48.90% 21.80% 3.70% 25.55% NA
Indica II  465 33.80% 12.00% 3.66% 50.54% NA
Indica III  913 53.70% 14.50% 3.50% 28.37% NA
Indica Intermediate  786 44.10% 14.10% 4.33% 37.40% NA
Temperate Japonica  767 34.30% 0.10% 0.52% 65.06% NA
Tropical Japonica  504 6.70% 0.00% 0.40% 92.86% NA
Japonica Intermediate  241 10.40% 0.00% 0.41% 89.21% NA
VI/Aromatic  96 29.20% 0.00% 4.17% 66.67% NA
Intermediate  90 35.60% 3.30% 4.44% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623387410 G -> C LOC_Os06g39400.1 missense_variant ; p.Asp298Glu; MODERATE nonsynonymous_codon ; D298E Average:74.86; most accessible tissue: Minghui63 young leaf, score: 89.871 unknown unknown TOLERATED 1.00
vg0623387410 G -> DEL LOC_Os06g39400.1 N frameshift_variant Average:74.86; most accessible tissue: Minghui63 young leaf, score: 89.871 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623387410 G C -0.12 -0.07 -0.06 -0.08 -0.1 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623387410 NA 9.41E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 3.98E-07 7.21E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 3.65E-06 1.31E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 2.33E-10 1.21E-12 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 1.24E-08 2.42E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 4.36E-06 1.80E-07 mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 4.13E-06 6.09E-09 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 3.84E-13 1.94E-12 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410 9.96E-10 6.76E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251