Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623387410:

Variant ID: vg0623387410 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23387410
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTAGACTGAGAAAGTCTCTAATCTCATATGACACTCCATAAACTTTAAACCAAGTTTTCTTTAGAACAAACTTCGCTTCAATCTCTTGCTCCCACTT[G/C]
TCAATGACTAGGTTCACATTAAAGTCAAAACTAGGAACACTGCCAACCCTACGCAACCTGTCTAATTCGATCACAGAGGGAAATTGAACCATATAAGTGT

Reverse complement sequence

ACACTTATATGGTTCAATTTCCCTCTGTGATCGAATTAGACAGGTTGCGTAGGGTTGGCAGTGTTCCTAGTTTTGACTTTAATGTGAACCTAGTCATTGA[C/G]
AAGTGGGAGCAAGAGATTGAAGCGAAGTTTGTTCTAAAGAAAACTTGGTTTAAAGTTTATGGAGTGTCATATGAGATTAGAGACTTTCTCAGTCTACATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	9.20%	2.56%	48.35%	NA
All Indica	2759	46.60%	15.50%	3.81%	34.07%	NA
All Japonica	1512	21.30%	0.10%	0.46%	78.17%	NA
Aus	269	81.40%	0.40%	0.37%	17.84%	NA
Indica I	595	48.90%	21.80%	3.70%	25.55%	NA
Indica II	465	33.80%	12.00%	3.66%	50.54%	NA
Indica III	913	53.70%	14.50%	3.50%	28.37%	NA
Indica Intermediate	786	44.10%	14.10%	4.33%	37.40%	NA
Temperate Japonica	767	34.30%	0.10%	0.52%	65.06%	NA
Tropical Japonica	504	6.70%	0.00%	0.40%	92.86%	NA
Japonica Intermediate	241	10.40%	0.00%	0.41%	89.21%	NA
VI/Aromatic	96	29.20%	0.00%	4.17%	66.67%	NA
Intermediate	90	35.60%	3.30%	4.44%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623387410	G -> C	LOC_Os06g39400.1	missense_variant ; p.Asp298Glu; MODERATE	nonsynonymous_codon ; D298E	Average:74.86; most accessible tissue: Minghui63 young leaf, score: 89.871	unknown	unknown	TOLERATED	1.00
vg0623387410	G -> DEL	LOC_Os06g39400.1	N	frameshift_variant	Average:74.86; most accessible tissue: Minghui63 young leaf, score: 89.871	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0623387410	G	C	-0.12	-0.07	-0.06	-0.08	-0.1	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623387410	NA	9.41E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	3.98E-07	7.21E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	3.65E-06	1.31E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	2.33E-10	1.21E-12	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	1.24E-08	2.42E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	4.36E-06	1.80E-07	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	4.13E-06	6.09E-09	mr1547_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	3.84E-13	1.94E-12	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623387410	9.96E-10	6.76E-11	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251