\
| Variant ID: vg0623363687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 23363687 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTTACTTTGGATTGGCATAGGGTCAGAGTTTGCAATATCACGCGAATACGAGCCTCATTACTTACCCATATTTTCTAATAAGGCAAAATAGTTTATTAG[A/G]
AAATAAAAGTTAATTTCTAGGTTAAACTTTTATATATTTGTTCGTAACGACTTAAAAACCAATGTTTAAAAGAATTAAGTTGAAAATGTATTAAATTTAA
TTAAATTTAATACATTTTCAACTTAATTCTTTTAAACATTGGTTTTTAAGTCGTTACGAACAAATATATAAAAGTTTAACCTAGAAATTAACTTTTATTT[T/C]
CTAATAAACTATTTTGCCTTATTAGAAAATATGGGTAAGTAATGAGGCTCGTATTCGCGTGATATTGCAAACTCTGACCCTATGCCAATCCAAAGTAAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 12.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.60% | 21.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 63.60% | 36.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623363687 | A -> G | LOC_Os06g39370.1 | upstream_gene_variant ; 3438.0bp to feature; MODIFIER | silent_mutation | Average:66.737; most accessible tissue: Callus, score: 80.203 | N | N | N | N |
| vg0623363687 | A -> G | LOC_Os06g39344-LOC_Os06g39370 | intergenic_region ; MODIFIER | silent_mutation | Average:66.737; most accessible tissue: Callus, score: 80.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623363687 | NA | 7.63E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 4.06E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 3.25E-07 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 1.55E-10 | mr1229 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 9.23E-07 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 7.07E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 2.64E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 5.39E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 4.65E-09 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 5.05E-09 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 2.83E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 1.31E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 4.44E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 2.55E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 3.38E-08 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 8.44E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623363687 | NA | 4.49E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |