\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623315068:

Variant ID: vg0623315068 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23315068
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTTACTCATCAGCGACTTGGACATATACAGGCTTGCCAACTTGTCCCAAATTTCCTTCAGTGATTTTTCATCCATGACCTGATACATGACAGAATCC[G/A]
AGAGACTCAAGCGTATTGTTGCAGCTGCCTGCGCCTTCATCTCCTCCCACTTGCCAGCATCCATCTTTTCCGGCATCGTCTCCTCAAGAGCCTTGGATAT

Reverse complement sequence

ATATCCAAGGCTCTTGAGGAGACGATGCCGGAAAAGATGGATGCTGGCAAGTGGGAGGAGATGAAGGCGCAGGCAGCTGCAACAATACGCTTGAGTCTCT[C/T]
GGATTCTGTCATGTATCAGGTCATGGATGAAAAATCACTGAAGGAAATTTGGGACAAGTTGGCAAGCCTGTATATGTCCAAGTCGCTGATGAGTAAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 16.90% 5.61% 3.36% NA
All Indica  2759 59.20% 25.60% 9.50% 5.73% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 67.30% 32.00% 0.74% 0.00% NA
Indica I  595 20.30% 50.90% 17.31% 11.43% NA
Indica II  465 93.50% 4.10% 1.72% 0.65% NA
Indica III  913 60.20% 23.80% 10.41% 5.59% NA
Indica Intermediate  786 67.20% 21.10% 7.12% 4.58% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623315068 G -> A LOC_Os06g39280.1 missense_variant ; p.Ser69Leu; MODERATE nonsynonymous_codon ; S69L Average:51.959; most accessible tissue: Minghui63 flag leaf, score: 70.17 benign -0.154 TOLERATED 0.09
vg0623315068 G -> DEL LOC_Os06g39280.1 N frameshift_variant Average:51.959; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623315068 NA 2.10E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 4.64E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 2.49E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 8.77E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 2.88E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 4.41E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 4.72E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 3.20E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 9.01E-08 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 3.58E-09 2.59E-12 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 3.22E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 1.34E-06 NA mr1788 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 2.19E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 4.87E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623315068 NA 6.87E-10 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251